ID: 1155055276

View in Genome Browser
Species Human (GRCh38)
Location 18:22176941-22176963
Sequence CGCTGTCGCCGCAGACCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155055270_1155055276 -3 Left 1155055270 18:22176921-22176943 CCACTCCCGCCCTCACGCACCGC 0: 1
1: 0
2: 1
3: 29
4: 357
Right 1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1155055271_1155055276 -8 Left 1155055271 18:22176926-22176948 CCCGCCCTCACGCACCGCTGTCG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1155055269_1155055276 -2 Left 1155055269 18:22176920-22176942 CCCACTCCCGCCCTCACGCACCG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1155055272_1155055276 -9 Left 1155055272 18:22176927-22176949 CCGCCCTCACGCACCGCTGTCGC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 76
1155055268_1155055276 6 Left 1155055268 18:22176912-22176934 CCGGCGCGCCCACTCCCGCCCTC 0: 1
1: 0
2: 3
3: 72
4: 565
Right 1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155055276 Original CRISPR CGCTGTCGCCGCAGACCTGC TGG Exonic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
904333397 1:29781460-29781482 GGCTGTCGTTGCAGACCAGCGGG + Intergenic
905752392 1:40477355-40477377 CGCTCTCGCTGCAGCCCTGGCGG - Exonic
912258752 1:108087550-108087572 CCCTGTCACCCCAGACCTCCTGG + Intergenic
919647219 1:200107084-200107106 AGCTGTGGGTGCAGACCTGCAGG + Intronic
920444150 1:206002942-206002964 CGCTGCTGCCTCAAACCTGCAGG - Intronic
922396182 1:225203051-225203073 GGCTGTCTCCCCAGTCCTGCAGG + Intronic
1062774593 10:135171-135193 CCCTGGCGCCGCGGGCCTGCGGG - Intronic
1071835766 10:89415376-89415398 CGGTTTCGCCGCAGCCCTGCAGG + Intronic
1074772098 10:116741486-116741508 CGCTCTCGCCGAGGCCCTGCAGG + Intronic
1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG + Intronic
1080422758 11:32126509-32126531 CACTCTCACCACAGACCTGCAGG + Intergenic
1085205725 11:74730989-74731011 CGCTCTAGCAGCAGACCTCCTGG - Exonic
1094021980 12:25924598-25924620 CACTGTCACGGCAGGCCTGCAGG + Intergenic
1095979557 12:47963698-47963720 CGCCAGCGTCGCAGACCTGCAGG - Exonic
1101716962 12:107319897-107319919 CGCGGCCGCCGCAGTCCCGCCGG + Exonic
1104729443 12:131096999-131097021 TGCTGTGGCTGCAGCCCTGCTGG + Intronic
1107108789 13:36674137-36674159 CGCTAGCGCAGGAGACCTGCCGG + Exonic
1113370222 13:109717725-109717747 CGCTGTGGTCTTAGACCTGCAGG - Intergenic
1113662528 13:112117327-112117349 CTCTGTCACCGCAGCCCTGGGGG + Intergenic
1122693830 14:103543430-103543452 GGCTGTGGCCGCTGCCCTGCTGG - Intergenic
1122779117 14:104136250-104136272 CGCTGTCGGCGCAGGCGGGCGGG + Intergenic
1123077363 14:105675120-105675142 CGCTGTCTCTTCAGAGCTGCGGG - Intergenic
1128841442 15:70854138-70854160 CGCAGTCGCTGCCGACCGGCTGG - Exonic
1132148934 15:99446240-99446262 CCCTGTCACCCCAGACCAGCTGG + Intergenic
1132495515 16:261469-261491 CGATGGGGCCCCAGACCTGCTGG + Exonic
1132518713 16:377702-377724 CGCTCTCCCGGGAGACCTGCAGG + Exonic
1132547190 16:538753-538775 CCCTGTGGCCTCAGAGCTGCAGG + Intronic
1134717942 16:16366214-16366236 GGCTGGCCCCGCCGACCTGCAGG - Intergenic
1134956809 16:18385945-18385967 GGCTGGCCCCGCCGACCTGCAGG + Intergenic
1135989692 16:27210465-27210487 CACTGTGGCCGCAGCCCTGCGGG + Exonic
1142199833 16:88755835-88755857 CACTGTCTCCTCAGACTTGCTGG - Intronic
1142289735 16:89188050-89188072 TGCTGTCCCCCCAGCCCTGCTGG + Intronic
1146923422 17:36728743-36728765 CTCTGCCTCCGCAGACCGGCCGG + Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148212398 17:45816501-45816523 TGCTGGCCCCGCAGCCCTGCGGG + Exonic
1149270095 17:54968325-54968347 CGCTGTCGCCGTGGGCATGCTGG - Exonic
1150620766 17:66806418-66806440 CCCTGTCCCTGCAGCCCTGCAGG + Exonic
1152403605 17:80083770-80083792 CACTGGCGGCTCAGACCTGCCGG + Intronic
1152552586 17:81037136-81037158 CCCTGTGGACGCAGACCAGCTGG + Intronic
1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG + Exonic
1160515067 18:79474173-79474195 CGCTGTCGACGTAAACCTGAGGG + Intronic
1160515126 18:79475002-79475024 CGCTGTCGACGTAAACCTGAGGG + Intronic
1160592548 18:79952223-79952245 CGCTGTCGCTGCAGAAACGCGGG + Intergenic
1162057467 19:8073260-8073282 CCCTGTCGCCCCCCACCTGCGGG - Exonic
1165274237 19:34734242-34734264 CGCTGTAGCCTCAGGCCTGACGG + Intronic
931385207 2:61792367-61792389 CACTGTAGATGCAGACCTGCAGG + Intergenic
936518831 2:113199118-113199140 CGCTGCCGCGGACGACCTGCTGG + Exonic
942454842 2:176130516-176130538 CGCTGTTGCCATAGAGCTGCAGG - Exonic
944770799 2:202912434-202912456 CGCTGTCTGCGCAGACCTACCGG + Intronic
1179888504 21:44324672-44324694 CCCTGCTGCGGCAGACCTGCCGG + Intronic
1181651922 22:24263643-24263665 CGGTGTGGCCGCAGACATCCAGG - Intergenic
1182442432 22:30372211-30372233 TGCTGGCCCAGCAGACCTGCTGG - Exonic
1183050698 22:35258097-35258119 AGCTGTTGCCGCAAAACTGCCGG + Intronic
1185391360 22:50563033-50563055 CTCGGACGCCGCAGACCTGTGGG - Intergenic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
949927835 3:9056319-9056341 CGCTGACCTGGCAGACCTGCAGG + Exonic
950371203 3:12532196-12532218 CCCTGCCCCTGCAGACCTGCTGG + Intronic
960810288 3:121621681-121621703 CGCTGGCGGGGCACACCTGCAGG - Exonic
963200146 3:142578438-142578460 GGCAGTCGCCACAAACCTGCGGG - Intronic
969261306 4:6035888-6035910 CGCTGTTGCCGCCTACCTGCTGG + Exonic
969648958 4:8452007-8452029 GGCTATCGCAGCATACCTGCTGG + Exonic
969736639 4:8996119-8996141 GGCTGGCGCTGAAGACCTGCTGG - Intergenic
974499734 4:62684362-62684384 CGTAGTCTCCGCAGACCAGCAGG + Intergenic
975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG + Intronic
985680070 5:1251375-1251397 CGCTGTAGCCGCAAACCCCCAGG - Intergenic
986151645 5:5135253-5135275 CGGTGGGTCCGCAGACCTGCTGG + Intergenic
998203944 5:140146066-140146088 CTCCGCCGCCGCAGACCAGCCGG + Intergenic
998230379 5:140357750-140357772 CCCAGTGGCTGCAGACCTGCCGG - Intergenic
1005705473 6:28447276-28447298 CGCTGTCGCCGTGGGCATGCTGG + Intergenic
1007074970 6:39060545-39060567 CTCTGTGGCCACAGCCCTGCTGG - Intronic
1008921725 6:56849999-56850021 CGCTGGAGCCTCAGACCTGCGGG + Intronic
1023089365 7:36603314-36603336 CCCTATCCCCGCAGACCTCCAGG + Intronic
1031586005 7:123533023-123533045 CGCTGTCTGCGCAGACCTACCGG - Intronic
1032390945 7:131555205-131555227 TGCTGTCCCCGCAGTCCTCCTGG + Intronic
1032781862 7:135170383-135170405 CGCTGGCGGCGCCGACCTGTGGG + Intronic
1036390375 8:8319212-8319234 CGAAGTGGCCGCAGTCCTGCTGG + Exonic
1042695804 8:71554286-71554308 CCAAGTCGCCACAGACCTGCGGG - Intronic
1049370521 8:142262101-142262123 CGGAGTCGCCGCAGGCCTGAAGG - Intronic
1057024530 9:91725139-91725161 CACTGTCACCGCAGCCCTGGAGG + Intronic
1057466313 9:95317448-95317470 CGCTCTCGCCGCTGACGTGTCGG + Intronic
1061089766 9:128420331-128420353 CGCTAGCTCCGCAGACCAGCCGG - Intronic
1195954799 X:110317834-110317856 CGCCGCCGCCGCAGCCCTGGGGG + Exonic
1200155181 X:153971313-153971335 CGCGGTCGTCGCAGCCCCGCCGG + Exonic