ID: 1155059889

View in Genome Browser
Species Human (GRCh38)
Location 18:22219191-22219213
Sequence CCCTGCGGCCTCGACTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155059884_1155059889 9 Left 1155059884 18:22219159-22219181 CCAGGCTGGGGAGCAGGGGTGTG No data
Right 1155059889 18:22219191-22219213 CCCTGCGGCCTCGACTTCCTGGG No data
1155059883_1155059889 10 Left 1155059883 18:22219158-22219180 CCCAGGCTGGGGAGCAGGGGTGT No data
Right 1155059889 18:22219191-22219213 CCCTGCGGCCTCGACTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155059889 Original CRISPR CCCTGCGGCCTCGACTTCCT GGG Intergenic