ID: 1155061281

View in Genome Browser
Species Human (GRCh38)
Location 18:22231104-22231126
Sequence CTGGTAAGCAGGAGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155061278_1155061281 -9 Left 1155061278 18:22231090-22231112 CCATCACCATGAAGCTGGTAAGC No data
Right 1155061281 18:22231104-22231126 CTGGTAAGCAGGAGAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155061281 Original CRISPR CTGGTAAGCAGGAGAATTGC TGG Intergenic
No off target data available for this crispr