ID: 1155062286

View in Genome Browser
Species Human (GRCh38)
Location 18:22239443-22239465
Sequence CAAGTTATGTAAAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155062286_1155062291 25 Left 1155062286 18:22239443-22239465 CCCTCCACACTTTACATAACTTG No data
Right 1155062291 18:22239491-22239513 GCAGATTCAAAGAAGCCTTAAGG No data
1155062286_1155062292 28 Left 1155062286 18:22239443-22239465 CCCTCCACACTTTACATAACTTG No data
Right 1155062292 18:22239494-22239516 GATTCAAAGAAGCCTTAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155062286 Original CRISPR CAAGTTATGTAAAGTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr