ID: 1155062584

View in Genome Browser
Species Human (GRCh38)
Location 18:22241852-22241874
Sequence CACAAATCACGGATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155062579_1155062584 2 Left 1155062579 18:22241827-22241849 CCTCTCTGGGGAAGAATTCTGCA No data
Right 1155062584 18:22241852-22241874 CACAAATCACGGATGGAACAAGG No data
1155062574_1155062584 22 Left 1155062574 18:22241807-22241829 CCAATTTCCTTAGGGCATGACCT No data
Right 1155062584 18:22241852-22241874 CACAAATCACGGATGGAACAAGG No data
1155062576_1155062584 15 Left 1155062576 18:22241814-22241836 CCTTAGGGCATGACCTCTCTGGG No data
Right 1155062584 18:22241852-22241874 CACAAATCACGGATGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155062584 Original CRISPR CACAAATCACGGATGGAACA AGG Intergenic
No off target data available for this crispr