ID: 1155064177

View in Genome Browser
Species Human (GRCh38)
Location 18:22254556-22254578
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155064177_1155064183 12 Left 1155064177 18:22254556-22254578 CCCCCTGGAGTCTTATGGGGCAG No data
Right 1155064183 18:22254591-22254613 TGCTCTGAACCCTTCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155064177 Original CRISPR CTGCCCCATAAGACTCCAGG GGG (reversed) Intergenic
No off target data available for this crispr