ID: 1155064545

View in Genome Browser
Species Human (GRCh38)
Location 18:22257169-22257191
Sequence GAGTAACAGCAGCAGAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155064545_1155064547 27 Left 1155064545 18:22257169-22257191 CCACTCTTCTGCTGCTGTTACTC No data
Right 1155064547 18:22257219-22257241 TGGTGAATTTTTCTCTTTTATGG No data
1155064545_1155064546 7 Left 1155064545 18:22257169-22257191 CCACTCTTCTGCTGCTGTTACTC No data
Right 1155064546 18:22257199-22257221 CATCAGCACACTTCTAAATTTGG No data
1155064545_1155064548 28 Left 1155064545 18:22257169-22257191 CCACTCTTCTGCTGCTGTTACTC No data
Right 1155064548 18:22257220-22257242 GGTGAATTTTTCTCTTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155064545 Original CRISPR GAGTAACAGCAGCAGAAGAG TGG (reversed) Intergenic
No off target data available for this crispr