ID: 1155069523

View in Genome Browser
Species Human (GRCh38)
Location 18:22301949-22301971
Sequence GTTTCTAAGCAGAAAGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155069515_1155069523 24 Left 1155069515 18:22301902-22301924 CCCTCACTTTCAGCTCAAGAGCC No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data
1155069519_1155069523 -4 Left 1155069519 18:22301930-22301952 CCCCTTTTCTATTTTGTGTGTTT No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data
1155069514_1155069523 25 Left 1155069514 18:22301901-22301923 CCCCTCACTTTCAGCTCAAGAGC No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data
1155069520_1155069523 -5 Left 1155069520 18:22301931-22301953 CCCTTTTCTATTTTGTGTGTTTC No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data
1155069518_1155069523 -3 Left 1155069518 18:22301929-22301951 CCCCCTTTTCTATTTTGTGTGTT No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data
1155069516_1155069523 23 Left 1155069516 18:22301903-22301925 CCTCACTTTCAGCTCAAGAGCCG No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data
1155069517_1155069523 3 Left 1155069517 18:22301923-22301945 CCGAATCCCCCTTTTCTATTTTG No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data
1155069521_1155069523 -6 Left 1155069521 18:22301932-22301954 CCTTTTCTATTTTGTGTGTTTCT No data
Right 1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155069523 Original CRISPR GTTTCTAAGCAGAAAGTGGT AGG Intergenic
No off target data available for this crispr