ID: 1155076135

View in Genome Browser
Species Human (GRCh38)
Location 18:22357191-22357213
Sequence GATGCTACAGAGCCCACGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155076135_1155076145 11 Left 1155076135 18:22357191-22357213 CCATACGTGGGCTCTGTAGCATC No data
Right 1155076145 18:22357225-22357247 TCAACATGAGGGAGGCTTCCTGG No data
1155076135_1155076147 18 Left 1155076135 18:22357191-22357213 CCATACGTGGGCTCTGTAGCATC No data
Right 1155076147 18:22357232-22357254 GAGGGAGGCTTCCTGGGTCACGG No data
1155076135_1155076146 12 Left 1155076135 18:22357191-22357213 CCATACGTGGGCTCTGTAGCATC No data
Right 1155076146 18:22357226-22357248 CAACATGAGGGAGGCTTCCTGGG No data
1155076135_1155076141 3 Left 1155076135 18:22357191-22357213 CCATACGTGGGCTCTGTAGCATC No data
Right 1155076141 18:22357217-22357239 GCTCCCCATCAACATGAGGGAGG No data
1155076135_1155076140 0 Left 1155076135 18:22357191-22357213 CCATACGTGGGCTCTGTAGCATC No data
Right 1155076140 18:22357214-22357236 CGGGCTCCCCATCAACATGAGGG No data
1155076135_1155076139 -1 Left 1155076135 18:22357191-22357213 CCATACGTGGGCTCTGTAGCATC No data
Right 1155076139 18:22357213-22357235 CCGGGCTCCCCATCAACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155076135 Original CRISPR GATGCTACAGAGCCCACGTA TGG (reversed) Intergenic
No off target data available for this crispr