ID: 1155076138

View in Genome Browser
Species Human (GRCh38)
Location 18:22357213-22357235
Sequence CCTCATGTTGATGGGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155076138_1155076149 17 Left 1155076138 18:22357213-22357235 CCGGGCTCCCCATCAACATGAGG No data
Right 1155076149 18:22357253-22357275 GGTGCTCACCTTCACCAAGCCGG No data
1155076138_1155076147 -4 Left 1155076138 18:22357213-22357235 CCGGGCTCCCCATCAACATGAGG No data
Right 1155076147 18:22357232-22357254 GAGGGAGGCTTCCTGGGTCACGG No data
1155076138_1155076146 -10 Left 1155076138 18:22357213-22357235 CCGGGCTCCCCATCAACATGAGG No data
Right 1155076146 18:22357226-22357248 CAACATGAGGGAGGCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155076138 Original CRISPR CCTCATGTTGATGGGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr