ID: 1155076146

View in Genome Browser
Species Human (GRCh38)
Location 18:22357226-22357248
Sequence CAACATGAGGGAGGCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155076138_1155076146 -10 Left 1155076138 18:22357213-22357235 CCGGGCTCCCCATCAACATGAGG No data
Right 1155076146 18:22357226-22357248 CAACATGAGGGAGGCTTCCTGGG No data
1155076135_1155076146 12 Left 1155076135 18:22357191-22357213 CCATACGTGGGCTCTGTAGCATC No data
Right 1155076146 18:22357226-22357248 CAACATGAGGGAGGCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155076146 Original CRISPR CAACATGAGGGAGGCTTCCT GGG Intergenic
No off target data available for this crispr