ID: 1155076146 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:22357226-22357248 |
| Sequence | CAACATGAGGGAGGCTTCCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1155076138_1155076146 | -10 | Left | 1155076138 | 18:22357213-22357235 | CCGGGCTCCCCATCAACATGAGG | No data | ||
| Right | 1155076146 | 18:22357226-22357248 | CAACATGAGGGAGGCTTCCTGGG | No data | ||||
| 1155076135_1155076146 | 12 | Left | 1155076135 | 18:22357191-22357213 | CCATACGTGGGCTCTGTAGCATC | No data | ||
| Right | 1155076146 | 18:22357226-22357248 | CAACATGAGGGAGGCTTCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1155076146 | Original CRISPR | CAACATGAGGGAGGCTTCCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||