ID: 1155076149

View in Genome Browser
Species Human (GRCh38)
Location 18:22357253-22357275
Sequence GGTGCTCACCTTCACCAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155076144_1155076149 8 Left 1155076144 18:22357222-22357244 CCATCAACATGAGGGAGGCTTCC No data
Right 1155076149 18:22357253-22357275 GGTGCTCACCTTCACCAAGCCGG No data
1155076143_1155076149 9 Left 1155076143 18:22357221-22357243 CCCATCAACATGAGGGAGGCTTC No data
Right 1155076149 18:22357253-22357275 GGTGCTCACCTTCACCAAGCCGG No data
1155076138_1155076149 17 Left 1155076138 18:22357213-22357235 CCGGGCTCCCCATCAACATGAGG No data
Right 1155076149 18:22357253-22357275 GGTGCTCACCTTCACCAAGCCGG No data
1155076142_1155076149 10 Left 1155076142 18:22357220-22357242 CCCCATCAACATGAGGGAGGCTT No data
Right 1155076149 18:22357253-22357275 GGTGCTCACCTTCACCAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155076149 Original CRISPR GGTGCTCACCTTCACCAAGC CGG Intergenic
No off target data available for this crispr