ID: 1155079217

View in Genome Browser
Species Human (GRCh38)
Location 18:22391226-22391248
Sequence CATCACTGGGAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155079217_1155079225 24 Left 1155079217 18:22391226-22391248 CCATCCACATTCTCCCAGTGATG No data
Right 1155079225 18:22391273-22391295 TTACTACATCAATAATGTGTTGG No data
1155079217_1155079226 25 Left 1155079217 18:22391226-22391248 CCATCCACATTCTCCCAGTGATG No data
Right 1155079226 18:22391274-22391296 TACTACATCAATAATGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155079217 Original CRISPR CATCACTGGGAGAATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr