ID: 1155080040

View in Genome Browser
Species Human (GRCh38)
Location 18:22400170-22400192
Sequence GGGTCACAGAACCAGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155080033_1155080040 25 Left 1155080033 18:22400122-22400144 CCTCATTTTACATATGGGTAAAC No data
Right 1155080040 18:22400170-22400192 GGGTCACAGAACCAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155080040 Original CRISPR GGGTCACAGAACCAGTGAGC TGG Intergenic
No off target data available for this crispr