ID: 1155080542

View in Genome Browser
Species Human (GRCh38)
Location 18:22406205-22406227
Sequence GCTGCCAGGAAGTTTAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155080539_1155080542 12 Left 1155080539 18:22406170-22406192 CCAGCATTTTAAAAACATGAAAC No data
Right 1155080542 18:22406205-22406227 GCTGCCAGGAAGTTTAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155080542 Original CRISPR GCTGCCAGGAAGTTTAAACT GGG Intergenic
No off target data available for this crispr