ID: 1155081619

View in Genome Browser
Species Human (GRCh38)
Location 18:22415947-22415969
Sequence CCTTCTTTGGATAAAATGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 5, 1: 5, 2: 1, 3: 23, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155081619_1155081623 4 Left 1155081619 18:22415947-22415969 CCATCCATTTTATCCAAAGAAGG 0: 5
1: 5
2: 1
3: 23
4: 194
Right 1155081623 18:22415974-22415996 TTAAAACTTCTGAGTTCTGCTGG 0: 7
1: 5
2: 0
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155081619 Original CRISPR CCTTCTTTGGATAAAATGGA TGG (reversed) Exonic
900273794 1:1809932-1809954 CCTCCTTTGAGTAAAATGAAGGG - Intronic
903727911 1:25465302-25465324 GCTTCTTTGGATAAATTCCAAGG + Intronic
907059736 1:51409346-51409368 CCTTCTTTAGAGGAAATAGAAGG - Intronic
907461075 1:54606052-54606074 CCTGCTCTGGAGAAAATAGATGG - Intronic
908249085 1:62251097-62251119 TCTTCTTTGGAGAAAAGGGCAGG + Intronic
908637290 1:66181912-66181934 CCTTCTTTTAAAAAAATAGAGGG + Intronic
909452542 1:75814100-75814122 CCTCCTTTGAATAAAACTGATGG - Intronic
911418059 1:97600886-97600908 GCATCTTTGGCTAAAATGAAAGG + Intronic
913609474 1:120496178-120496200 CCTGATTTGAATAAAATTGAAGG + Intergenic
913985985 1:143566510-143566532 CCTGATTTGAATAAAATTGAAGG - Intergenic
914204349 1:145514338-145514360 CCTGATTTGAATAAAATTGAAGG - Intergenic
914483471 1:148087526-148087548 CCTGATTTGAATAAAATTGAAGG - Intergenic
914581716 1:149025661-149025683 CCTGATTTGAATAAAATTGAAGG - Intronic
916953124 1:169801734-169801756 CCTTTTTTGTTTTAAATGGAGGG + Intronic
916958474 1:169865083-169865105 TCTTCTTAGGGTAAAAAGGAGGG - Intronic
917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG + Intergenic
918834242 1:189439921-189439943 GCTTCTTAGGATTAAATGGTTGG - Intergenic
919959680 1:202453818-202453840 ATTTCTTTACATAAAATGGAAGG + Intronic
920925208 1:210334596-210334618 CCTTCTGTGGGTAATATGGTTGG + Intronic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
924627319 1:245706348-245706370 CCTTCTTTGGATAGAAGGCAAGG + Intronic
1063484865 10:6410441-6410463 CCTTCTTGGGAGGAAATGTAGGG + Intergenic
1063894440 10:10665052-10665074 CCTTCTTTGGTTAAAATTCGTGG + Intergenic
1068229035 10:54146297-54146319 CATTCTTTTCATAAAATGCAAGG - Intronic
1072741253 10:97911282-97911304 CCTGCTTTGTAGAAAATGAAGGG - Intronic
1075503752 10:123002974-123002996 GATTATTTGGAAAAAATGGATGG + Intronic
1076391664 10:130107975-130107997 CCTCCTTTGGATAAAATGGATGG + Intergenic
1076577735 10:131481561-131481583 CCTTCAATGGTTAAAATGCAAGG + Intergenic
1077797200 11:5505199-5505221 TTTTCTTTGGCTCAAATGGAAGG + Intronic
1079391862 11:20028814-20028836 CTTTCTTTGGATAAATAGCATGG + Intronic
1080910585 11:36594061-36594083 TCTTCTTTGGACAAAAAGGCTGG - Exonic
1081248066 11:40794540-40794562 CTTTCCTTGGATACAATGGAGGG + Intronic
1081441879 11:43089778-43089800 CTTTCTTTGGCTAACAGGGAGGG + Intergenic
1082893246 11:58162859-58162881 TCTTCTGAGGACAAAATGGAAGG + Intronic
1084505328 11:69563257-69563279 CATTCTTTGGAGAAAAAGTATGG - Intergenic
1087061196 11:93979508-93979530 CATTCTGTGGAAAAAATTGAGGG + Intergenic
1087698470 11:101408528-101408550 CCCTCTGTGGATAAAATCCAAGG + Intergenic
1088057103 11:105597372-105597394 TCTTCTGCGAATAAAATGGAAGG + Intergenic
1089414166 11:118273023-118273045 CCTTCTTGGGCTAAAATAGAGGG - Intergenic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1091807978 12:3369605-3369627 CCTTATTTGGAAAAATAGGAGGG + Intergenic
1093360191 12:18216445-18216467 TCTTCTTTGGAGAAATTGAATGG - Intronic
1095450780 12:42328424-42328446 CTTTTTTAGGGTAAAATGGAGGG + Intronic
1097379949 12:58882799-58882821 CATTATTTGGATAAATGGGAGGG + Intronic
1098662164 12:73108939-73108961 CTTTCTTTTTACAAAATGGAAGG - Intergenic
1101268515 12:103117776-103117798 CCTTCATTGAATATACTGGAAGG - Intergenic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1104257021 12:127147743-127147765 CCCTCTTTGGAAAAAGTAGAAGG - Intergenic
1104560352 12:129838501-129838523 CTTTCTTTGGATTCAGTGGAAGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107692057 13:42963080-42963102 CCTTTGAAGGATAAAATGGAAGG + Intronic
1108371042 13:49768923-49768945 CCTTATTTGCATGAAATGTAAGG - Intronic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1109127019 13:58530552-58530574 CCTCCTTTGGATAAAATGGATGG + Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1111151029 13:84253862-84253884 ATTTCTTTGGGGAAAATGGAAGG - Intergenic
1111651704 13:91099065-91099087 CCTTTCTTTGATAAAATGGAAGG + Intergenic
1112816631 13:103280518-103280540 CCATCCTTGGATATCATGGAGGG - Intergenic
1113046078 13:106156760-106156782 CCTTCCTTGGAGAACACGGAGGG + Intergenic
1116705939 14:48300325-48300347 CATATTTTGGTTAAAATGGAAGG + Intergenic
1120391411 14:83913071-83913093 CCTTATGGGAATAAAATGGAGGG - Intergenic
1120473427 14:84956632-84956654 CTTTCATGGGATAAGATGGATGG + Intergenic
1120715822 14:87839864-87839886 CCTGGTTTGGATAAAATATATGG + Intronic
1122016416 14:98800616-98800638 ACTTCTTTGTATAACATGAATGG + Intergenic
1127003691 15:54541113-54541135 CCTTCTCTGGATAAAGAGGAAGG - Intronic
1128854447 15:70996345-70996367 CCTTGTTTAGATAAAATGCAAGG - Intronic
1129143586 15:73626023-73626045 CCTTCTTCGACTATAATGGACGG + Intronic
1133119202 16:3595937-3595959 CTGTCTTTGGTTAAAGTGGAAGG + Intronic
1135479354 16:22809268-22809290 CATTCTTTGGATAAAATCAGAGG - Intergenic
1136406238 16:30049263-30049285 CCTCCTTAGTATAAAATGAAAGG - Intronic
1138254569 16:55543955-55543977 CCTTTTTAAGATAAAATGTATGG - Intronic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1144601336 17:16617380-16617402 CGTGCTTTGGACAAACTGGATGG - Intergenic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1151032162 17:70754138-70754160 CTTTCTTTTGATGAAATGGATGG - Intergenic
1151173634 17:72269086-72269108 CCTTCTGGGGATAAAGTGGGTGG - Intergenic
1153014101 18:567725-567747 CCACCTATGGATAAACTGGATGG + Intergenic
1153152038 18:2106637-2106659 CCTAAGTTGGGTAAAATGGAAGG - Intergenic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155952155 18:31924996-31925018 CCTTCTCTGGATAAACTAAATGG + Intronic
1156205812 18:34884333-34884355 CCTTCTATGAGTAAAATGAAGGG + Intronic
1156234609 18:35190057-35190079 CCGTATTTACATAAAATGGATGG + Intergenic
1157155078 18:45257456-45257478 TCTTCTTTTAATAAAATGGCAGG + Intronic
1158007090 18:52685233-52685255 CCTTCTTAGAATACATTGGAGGG + Intronic
1158193389 18:54856577-54856599 CCTGCTTTGGATAAACTGCATGG - Intronic
1162983508 19:14254377-14254399 CCTCCTGTGGAAAAAATGAATGG - Intergenic
1164486981 19:28666922-28666944 CCTTATGGGGACAAAATGGAAGG - Intergenic
1166488835 19:43239745-43239767 TCTTCTTTGGAGAAATGGGAGGG + Intronic
928890582 2:36198997-36199019 GCTTCTTTTGATGAAGTGGATGG + Intergenic
929864927 2:45709697-45709719 ACTCTTTTGAATAAAATGGAAGG + Intronic
931745377 2:65287437-65287459 GCTTCTTTGGATTAAATTTAAGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935056446 2:99571667-99571689 TCATCTTTGCATAGAATGGAGGG + Intronic
937009853 2:118552627-118552649 TTTTCTTTGGATAAAACAGATGG - Intergenic
937534282 2:122866940-122866962 TCTTCTTTGGATTAAATAGTGGG - Intergenic
938745541 2:134274819-134274841 CCCACTTTGGAAAAAATGCAGGG - Intronic
939067225 2:137498563-137498585 CCATCTTTGGATCTATTGGATGG + Intronic
939146980 2:138426991-138427013 CCTATTTTGAATAAAATGGAGGG - Intergenic
939357669 2:141125163-141125185 TCTTCTTTGGAAAAAATAAAGGG + Intronic
939716582 2:145591406-145591428 TCTGTTTTGGATAAAATGCAAGG - Intergenic
941615513 2:167714110-167714132 CCTTGTTTGGATAAAATGGATGG - Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
942759740 2:179384098-179384120 CCTTCTTTTGTTAAAACAGAGGG - Intergenic
943829359 2:192439546-192439568 GCTTCTTTGGGGAAAATTGATGG + Intergenic
944838769 2:203605738-203605760 CTGTCTTTGGCTAAAATGGGTGG + Intergenic
944968474 2:204963249-204963271 TCTTATGTGGATAAAATGTATGG + Intronic
947125486 2:226864209-226864231 ATTTCTTTGAAAAAAATGGAGGG + Intronic
947137608 2:226990811-226990833 GCTTCTTTGAGTAAAATTGAGGG + Intronic
948198741 2:236114215-236114237 CCTTCCTTGGGGAAAATGAAAGG + Intronic
948224988 2:236302046-236302068 GTTGCTTTGGATAAAATGTATGG + Intergenic
1168861185 20:1047127-1047149 CGTTCTTTGGATGAGATGGTTGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170231463 20:14051477-14051499 CATACTTTGGGTAAAAGGGAAGG - Intronic
1170333749 20:15245161-15245183 ACTGCTTTGGTTTAAATGGAAGG + Intronic
1171024760 20:21619785-21619807 CCCTCTTTTGATTAAAAGGAGGG + Intergenic
1171229839 20:23475490-23475512 CCTTGTTTGGAGATAACGGAGGG + Intergenic
1173004581 20:39130035-39130057 CCATCCCTGGATAAAGTGGAGGG + Intergenic
1173488681 20:43460132-43460154 CGTGCTTTGGACAAACTGGATGG + Exonic
1174962104 20:55170117-55170139 CCTTTTTTTGAGAAAGTGGAAGG + Intergenic
1175321531 20:58091756-58091778 CCTCTTTAGCATAAAATGGATGG - Intergenic
1175692309 20:61074319-61074341 TCTTCTTTGGACAAGATTGAAGG + Intergenic
1176879677 21:14175866-14175888 CCTTCTTTCCATACAATGAAAGG - Intronic
1176879781 21:14177649-14177671 CCTTCTTTCTATACAATGAAAGG + Intronic
1177603022 21:23339801-23339823 TGTTCTGAGGATAAAATGGAAGG - Intergenic
1179144536 21:38756043-38756065 ATTTCATTGGTTAAAATGGAGGG - Intergenic
1180593025 22:16956669-16956691 CCTTCCTTGGGTAAAAGGGAGGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181561104 22:23701089-23701111 CCTTTTTTGGAAAATATGGTAGG - Intergenic
1182258824 22:29058103-29058125 CCTTATTTTTATAAAGTGGATGG - Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
951889814 3:27558018-27558040 ATTTCTTTGGATGAAGTGGAGGG - Intergenic
954116514 3:48469644-48469666 CCTGCTTTGGCTAAGCTGGAGGG - Intronic
955472555 3:59301019-59301041 ACTTCTTCTGATAAAGTGGAAGG + Intergenic
956623053 3:71240300-71240322 CATTCTTTGGTTTGAATGGAAGG + Intronic
957195844 3:77066824-77066846 TTTTCTTTGGAGAAAATAGAAGG - Intronic
957427405 3:80056033-80056055 ACTTATTTGGAAAATATGGATGG - Intergenic
958174595 3:89980310-89980332 CCTTCTTTGTACAATATGGTGGG + Intergenic
958898306 3:99855183-99855205 TCTTCTTTGAAAAAAATGGGTGG - Intronic
959637120 3:108588095-108588117 CTTTCTTTGAATAAACAGGAAGG - Intronic
960639494 3:119812412-119812434 CCCTGCTTGGTTAAAATGGAGGG - Intronic
961036839 3:123648400-123648422 ACTTCTGTGGATCAAATGGAAGG + Intronic
961676300 3:128569038-128569060 CATTCTTTGGGTAAAATGTTGGG - Intergenic
962355814 3:134693563-134693585 GATTCTTTATATAAAATGGAGGG + Intronic
962613658 3:137103220-137103242 CCTTCTTTGTGTGATATGGAAGG + Intergenic
963655325 3:148041539-148041561 CCTACTTTGGATGAAATGAAAGG - Intergenic
965206585 3:165725907-165725929 CTTTCTTTATATAAAATGTAAGG + Intergenic
966029585 3:175328670-175328692 CAGTCTTTGGCTAAAATGCAGGG - Intronic
966260076 3:177966131-177966153 GCTTCTTTTGAAAAAATGGCTGG - Intergenic
967493060 3:190115271-190115293 TCTTCTTAGGATTAAAAGGAAGG - Intronic
973057329 4:45677817-45677839 CCATTTTGGGACAAAATGGATGG - Intergenic
974811771 4:66955078-66955100 TCTTCTTTGTTTAAAATGGCTGG - Intergenic
975546362 4:75564258-75564280 CCTTCGTGGAAAAAAATGGAAGG - Exonic
978583132 4:110252162-110252184 AGTTCTTTGTGTAAAATGGAAGG + Intergenic
978741598 4:112144255-112144277 TTTTCCTTGAATAAAATGGATGG + Intergenic
980380945 4:132015102-132015124 CCATCTTTTTATAATATGGAAGG - Intergenic
983177635 4:164610199-164610221 CTTTCTTTTCATAAGATGGAGGG + Intergenic
983502316 4:168513194-168513216 CCTTCTTTGCATCACATTGAAGG - Intronic
984297565 4:177872810-177872832 CTTTCTTTGGGTAAAACAGAAGG - Intronic
991325782 5:65430497-65430519 TATTCTTTGGAGAAACTGGATGG + Intronic
993354206 5:86885530-86885552 CCTTCTGTGGATGAAATGTATGG + Intergenic
993522026 5:88914880-88914902 CCTTCTCTTTATAAACTGGAGGG - Intergenic
994211489 5:97091552-97091574 CGTCCTTTGGATAAAAAGAAAGG + Intronic
994289885 5:98016142-98016164 CCCTCTTTATATAAAATTGAAGG - Intergenic
995705723 5:114987449-114987471 TCTTCCTTGAAAAAAATGGATGG + Intergenic
998593430 5:143501927-143501949 CCTTCTTCAGATAAGATGGCAGG - Intergenic
999547442 5:152645781-152645803 CCCTCTTTGAATCAAATGAAGGG - Intergenic
999568601 5:152893213-152893235 CCTTGTTTGGTCCAAATGGAAGG + Intergenic
1001402347 5:171452956-171452978 CCGTCTTCAGATCAAATGGAAGG + Intronic
1002484131 5:179523233-179523255 CCTTCTCTGGAAAGCATGGAGGG - Intergenic
1002500434 5:179644248-179644270 CCTTCTCTGGAAAGCATGGAGGG + Intronic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1006974440 6:38085351-38085373 CCTTGTATGGATAGATTGGATGG - Intronic
1008138367 6:47803101-47803123 CATTCTGTGGATAAAATAGAAGG + Intronic
1009833574 6:68969841-68969863 CCTTCTGTGGGTAGAATAGATGG - Intronic
1010035592 6:71321909-71321931 CCTTCCTTAAATAAAATGGATGG - Intergenic
1012532794 6:100258697-100258719 CCTTTTTTGGTTAATATTGAGGG + Intergenic
1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG + Intergenic
1014236930 6:118968488-118968510 CCATATTGGGATAAAATGCAAGG - Intronic
1017273372 6:152535918-152535940 ACTTCTTTGCCTAAAATGCAAGG + Intronic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1020217091 7:6201455-6201477 CCTTCTTTGGATTAGGTGAAAGG + Intronic
1020399298 7:7757017-7757039 CCTTCTTTGTTTTAAATGAATGG + Intronic
1021036299 7:15803481-15803503 CCTTCTTTTGTGAAAATAGAAGG + Intergenic
1021512682 7:21451466-21451488 AGTTCTTTGGGGAAAATGGATGG + Intronic
1024389353 7:48789352-48789374 CATTTTGTGGAAAAAATGGATGG + Intergenic
1026185652 7:68080920-68080942 CCTTCTTTTGAAAATATGGAGGG - Intergenic
1028268382 7:88757464-88757486 CCATATTTTTATAAAATGGAAGG - Intergenic
1028683124 7:93561574-93561596 CCATCATTAGATAAAAAGGAGGG + Intronic
1028952493 7:96652430-96652452 TCTTCTTTGTAAAAAATTGAGGG + Intronic
1029859231 7:103551519-103551541 CCTGCTTTTTATAAAATGAAGGG - Intronic
1029924261 7:104298898-104298920 AATTCTTTGAACAAAATGGAAGG + Intergenic
1032273603 7:130434038-130434060 TCTTCTGTGGATAAAAAAGATGG + Intronic
1033678971 7:143573759-143573781 ACTTCTTTGGATAAAATGGATGG + Exonic
1033692867 7:143755695-143755717 ACTTCTTTGGATAAAATGGATGG - Exonic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1036608188 8:10326620-10326642 ACAACTTTGCATAAAATGGAGGG + Intronic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1039341486 8:36655233-36655255 TCTGTTTTGGATAAAATAGATGG + Intergenic
1040004459 8:42607802-42607824 CATTGTTTGGATAAAAGAGATGG + Intergenic
1042255231 8:66795887-66795909 CCTTCTTTGAGTAGAATGCAAGG + Intronic
1042762941 8:72290565-72290587 CCTTCTTAGGATAGAAGGGAGGG - Intergenic
1043111350 8:76186916-76186938 CCATCTTGTGATAAAATGGAAGG - Intergenic
1043231819 8:77812312-77812334 CCTTCTTTGCATAAAAAGATTGG + Intergenic
1044738509 8:95302519-95302541 CCTTCTTTTGATGAAAGAGAAGG + Intergenic
1046593294 8:116231033-116231055 CCTTCATTGGAAAAGATGCATGG - Intergenic
1047268632 8:123332948-123332970 CCTTCTTTTGAAAAAATGGGAGG - Intronic
1048536227 8:135298149-135298171 ACTTCTGTTGATAAAATGAAAGG + Intergenic
1050193328 9:3053242-3053264 TCTTCTTTGGATAAGACAGAGGG + Intergenic
1050665457 9:7930961-7930983 CTCTCTTTGGATTAATTGGAAGG - Intergenic
1052365599 9:27608839-27608861 ACTTCTTTGGATAAAGTGGATGG - Intergenic
1056940362 9:90950253-90950275 CCTTCTTTTGACAAAATGAAAGG - Intergenic
1058327903 9:103721147-103721169 CTTTCTTTGAATAAGATGGAGGG - Intergenic
1187132290 X:16514439-16514461 CCTTCTGTGGCTATATTGGAGGG - Intergenic
1189609762 X:42719673-42719695 TCTTCTTTGGAAAAAAAGAAAGG - Intergenic
1189922191 X:45913337-45913359 CTTGCTTTGGACAAACTGGATGG + Intergenic
1193648935 X:84106692-84106714 CCTCTTTTGAATAAAATAGAAGG - Intronic
1195449888 X:104999230-104999252 CCTTCTATTGTTACAATGGATGG - Intronic
1198603781 X:138314124-138314146 GCCTCTGTGGATAGAATGGAAGG - Intergenic
1199676914 X:150196781-150196803 CCTTATTTGGAAAAAAAAGAGGG + Intergenic
1200378250 X:155807027-155807049 TCTCCTTTGGACAAAATGCAGGG - Intergenic
1201342816 Y:12952600-12952622 CGTTTGTTGGATAAGATGGAGGG - Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic