ID: 1155085405

View in Genome Browser
Species Human (GRCh38)
Location 18:22453229-22453251
Sequence TATTATGTAACATCCCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155085405_1155085406 11 Left 1155085405 18:22453229-22453251 CCAATAGGGGATGTTACATAATA No data
Right 1155085406 18:22453263-22453285 CACATTTCTTCTCTGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155085405 Original CRISPR TATTATGTAACATCCCCTAT TGG (reversed) Intergenic
No off target data available for this crispr