ID: 1155085475

View in Genome Browser
Species Human (GRCh38)
Location 18:22453911-22453933
Sequence CTGGGGAGTCAGGATTTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155085467_1155085475 -2 Left 1155085467 18:22453890-22453912 CCAGAAAGGAAGATGCTCTAGCT No data
Right 1155085475 18:22453911-22453933 CTGGGGAGTCAGGATTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155085475 Original CRISPR CTGGGGAGTCAGGATTTAGG GGG Intergenic
No off target data available for this crispr