ID: 1155086703

View in Genome Browser
Species Human (GRCh38)
Location 18:22466020-22466042
Sequence GGGGTAGTTTTCCTGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155086701_1155086703 -10 Left 1155086701 18:22466007-22466029 CCCAGCTTCTCTGGGGGTAGTTT No data
Right 1155086703 18:22466020-22466042 GGGGTAGTTTTCCTGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155086703 Original CRISPR GGGGTAGTTTTCCTGCTGCA TGG Intergenic
No off target data available for this crispr