ID: 1155086705

View in Genome Browser
Species Human (GRCh38)
Location 18:22466033-22466055
Sequence TGCTGCATGGCACACATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155086702_1155086705 2 Left 1155086702 18:22466008-22466030 CCAGCTTCTCTGGGGGTAGTTTT No data
Right 1155086705 18:22466033-22466055 TGCTGCATGGCACACATTTGAGG No data
1155086701_1155086705 3 Left 1155086701 18:22466007-22466029 CCCAGCTTCTCTGGGGGTAGTTT No data
Right 1155086705 18:22466033-22466055 TGCTGCATGGCACACATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155086705 Original CRISPR TGCTGCATGGCACACATTTG AGG Intergenic
No off target data available for this crispr