ID: 1155086918

View in Genome Browser
Species Human (GRCh38)
Location 18:22467724-22467746
Sequence AACCCATCGATTCTGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155086918_1155086920 1 Left 1155086918 18:22467724-22467746 CCATGTTCCAGAATCGATGGGTT No data
Right 1155086920 18:22467748-22467770 TACTGCTGTGCCCAGTCAACAGG No data
1155086918_1155086923 22 Left 1155086918 18:22467724-22467746 CCATGTTCCAGAATCGATGGGTT No data
Right 1155086923 18:22467769-22467791 GGATACCTAAGCTTTGACTTTGG No data
1155086918_1155086924 23 Left 1155086918 18:22467724-22467746 CCATGTTCCAGAATCGATGGGTT No data
Right 1155086924 18:22467770-22467792 GATACCTAAGCTTTGACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155086918 Original CRISPR AACCCATCGATTCTGGAACA TGG (reversed) Intergenic
No off target data available for this crispr