ID: 1155087424

View in Genome Browser
Species Human (GRCh38)
Location 18:22471934-22471956
Sequence CACTGTGTCTGAAGGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155087424_1155087429 -3 Left 1155087424 18:22471934-22471956 CCCAGTGCCCTTCAGACACAGTG No data
Right 1155087429 18:22471954-22471976 GTGACTCAGGTTTGAGCCGACGG No data
1155087424_1155087430 1 Left 1155087424 18:22471934-22471956 CCCAGTGCCCTTCAGACACAGTG No data
Right 1155087430 18:22471958-22471980 CTCAGGTTTGAGCCGACGGCAGG No data
1155087424_1155087435 26 Left 1155087424 18:22471934-22471956 CCCAGTGCCCTTCAGACACAGTG No data
Right 1155087435 18:22471983-22472005 CGTTATCGAAGGTCCACGGTTGG No data
1155087424_1155087433 15 Left 1155087424 18:22471934-22471956 CCCAGTGCCCTTCAGACACAGTG No data
Right 1155087433 18:22471972-22471994 GACGGCAGGGACGTTATCGAAGG No data
1155087424_1155087434 22 Left 1155087424 18:22471934-22471956 CCCAGTGCCCTTCAGACACAGTG No data
Right 1155087434 18:22471979-22472001 GGGACGTTATCGAAGGTCCACGG No data
1155087424_1155087436 27 Left 1155087424 18:22471934-22471956 CCCAGTGCCCTTCAGACACAGTG No data
Right 1155087436 18:22471984-22472006 GTTATCGAAGGTCCACGGTTGGG No data
1155087424_1155087431 2 Left 1155087424 18:22471934-22471956 CCCAGTGCCCTTCAGACACAGTG No data
Right 1155087431 18:22471959-22471981 TCAGGTTTGAGCCGACGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155087424 Original CRISPR CACTGTGTCTGAAGGGCACT GGG (reversed) Intergenic
No off target data available for this crispr