ID: 1155100631

View in Genome Browser
Species Human (GRCh38)
Location 18:22606947-22606969
Sequence GCTCTGAAGCCCTGGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155100631_1155100634 -9 Left 1155100631 18:22606947-22606969 CCTCACAGCCAGGGCTTCAGAGC No data
Right 1155100634 18:22606961-22606983 CTTCAGAGCTGCTTCCCGGCAGG No data
1155100631_1155100641 30 Left 1155100631 18:22606947-22606969 CCTCACAGCCAGGGCTTCAGAGC No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155100631 Original CRISPR GCTCTGAAGCCCTGGCTGTG AGG (reversed) Intergenic
No off target data available for this crispr