ID: 1155100632

View in Genome Browser
Species Human (GRCh38)
Location 18:22606955-22606977
Sequence GGGAAGCAGCTCTGAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155100632_1155100641 22 Left 1155100632 18:22606955-22606977 CCAGGGCTTCAGAGCTGCTTCCC No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155100632 Original CRISPR GGGAAGCAGCTCTGAAGCCC TGG (reversed) Intergenic
No off target data available for this crispr