ID: 1155100636

View in Genome Browser
Species Human (GRCh38)
Location 18:22606976-22606998
Sequence AGTGGTATGGCTGGGCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155100636_1155100644 27 Left 1155100636 18:22606976-22606998 CCGGCAGGCCCAGCCATACCACT No data
Right 1155100644 18:22607026-22607048 TCTTCAGAGAAAGCGTGGTCAGG No data
1155100636_1155100641 1 Left 1155100636 18:22606976-22606998 CCGGCAGGCCCAGCCATACCACT No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data
1155100636_1155100643 22 Left 1155100636 18:22606976-22606998 CCGGCAGGCCCAGCCATACCACT No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155100636 Original CRISPR AGTGGTATGGCTGGGCCTGC CGG (reversed) Intergenic
No off target data available for this crispr