ID: 1155100638

View in Genome Browser
Species Human (GRCh38)
Location 18:22606985-22607007
Sequence CAGAGTGCTAGTGGTATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155100638_1155100644 18 Left 1155100638 18:22606985-22607007 CCAGCCATACCACTAGCACTCTG No data
Right 1155100644 18:22607026-22607048 TCTTCAGAGAAAGCGTGGTCAGG No data
1155100638_1155100641 -8 Left 1155100638 18:22606985-22607007 CCAGCCATACCACTAGCACTCTG No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data
1155100638_1155100643 13 Left 1155100638 18:22606985-22607007 CCAGCCATACCACTAGCACTCTG No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155100638 Original CRISPR CAGAGTGCTAGTGGTATGGC TGG (reversed) Intergenic