ID: 1155100639

View in Genome Browser
Species Human (GRCh38)
Location 18:22606989-22607011
Sequence GCTTCAGAGTGCTAGTGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155100639_1155100644 14 Left 1155100639 18:22606989-22607011 CCATACCACTAGCACTCTGAAGC No data
Right 1155100644 18:22607026-22607048 TCTTCAGAGAAAGCGTGGTCAGG No data
1155100639_1155100643 9 Left 1155100639 18:22606989-22607011 CCATACCACTAGCACTCTGAAGC No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155100639 Original CRISPR GCTTCAGAGTGCTAGTGGTA TGG (reversed) Intergenic
No off target data available for this crispr