ID: 1155100641

View in Genome Browser
Species Human (GRCh38)
Location 18:22607000-22607022
Sequence GCACTCTGAAGCATTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155100637_1155100641 -7 Left 1155100637 18:22606984-22607006 CCCAGCCATACCACTAGCACTCT No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data
1155100638_1155100641 -8 Left 1155100638 18:22606985-22607007 CCAGCCATACCACTAGCACTCTG No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data
1155100632_1155100641 22 Left 1155100632 18:22606955-22606977 CCAGGGCTTCAGAGCTGCTTCCC No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data
1155100635_1155100641 2 Left 1155100635 18:22606975-22606997 CCCGGCAGGCCCAGCCATACCAC No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data
1155100631_1155100641 30 Left 1155100631 18:22606947-22606969 CCTCACAGCCAGGGCTTCAGAGC No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data
1155100636_1155100641 1 Left 1155100636 18:22606976-22606998 CCGGCAGGCCCAGCCATACCACT No data
Right 1155100641 18:22607000-22607022 GCACTCTGAAGCATTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155100641 Original CRISPR GCACTCTGAAGCATTGCCTC TGG Intergenic
No off target data available for this crispr