ID: 1155100643

View in Genome Browser
Species Human (GRCh38)
Location 18:22607021-22607043
Sequence GGCTCTCTTCAGAGAAAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155100636_1155100643 22 Left 1155100636 18:22606976-22606998 CCGGCAGGCCCAGCCATACCACT No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data
1155100635_1155100643 23 Left 1155100635 18:22606975-22606997 CCCGGCAGGCCCAGCCATACCAC No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data
1155100638_1155100643 13 Left 1155100638 18:22606985-22607007 CCAGCCATACCACTAGCACTCTG No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data
1155100639_1155100643 9 Left 1155100639 18:22606989-22607011 CCATACCACTAGCACTCTGAAGC No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data
1155100640_1155100643 4 Left 1155100640 18:22606994-22607016 CCACTAGCACTCTGAAGCATTGC No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data
1155100637_1155100643 14 Left 1155100637 18:22606984-22607006 CCCAGCCATACCACTAGCACTCT No data
Right 1155100643 18:22607021-22607043 GGCTCTCTTCAGAGAAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155100643 Original CRISPR GGCTCTCTTCAGAGAAAGCG TGG Intergenic
No off target data available for this crispr