ID: 1155101613

View in Genome Browser
Species Human (GRCh38)
Location 18:22615988-22616010
Sequence ATGATTAAGCTGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155101611_1155101613 0 Left 1155101611 18:22615965-22615987 CCATTTTAAATCAAAAGCTAGAA No data
Right 1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155101613 Original CRISPR ATGATTAAGCTGAATGAGGA AGG Intergenic
No off target data available for this crispr