ID: 1155107430

View in Genome Browser
Species Human (GRCh38)
Location 18:22681393-22681415
Sequence GGTGAAGTATTTCCAGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155107427_1155107430 23 Left 1155107427 18:22681347-22681369 CCTAACTGGTCTAAGCATCTGGA No data
Right 1155107430 18:22681393-22681415 GGTGAAGTATTTCCAGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155107430 Original CRISPR GGTGAAGTATTTCCAGCTAT AGG Intergenic
No off target data available for this crispr