ID: 1155108461

View in Genome Browser
Species Human (GRCh38)
Location 18:22690038-22690060
Sequence TTGTAACTCTGGGGGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155108461_1155108471 -2 Left 1155108461 18:22690038-22690060 CCCTCCCTCCCCCAGAGTTACAA No data
Right 1155108471 18:22690059-22690081 AATCTAATTGGTCTAGGATGAGG No data
1155108461_1155108470 -8 Left 1155108461 18:22690038-22690060 CCCTCCCTCCCCCAGAGTTACAA No data
Right 1155108470 18:22690053-22690075 AGTTACAATCTAATTGGTCTAGG No data
1155108461_1155108472 -1 Left 1155108461 18:22690038-22690060 CCCTCCCTCCCCCAGAGTTACAA No data
Right 1155108472 18:22690060-22690082 ATCTAATTGGTCTAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155108461 Original CRISPR TTGTAACTCTGGGGGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr