ID: 1155112243

View in Genome Browser
Species Human (GRCh38)
Location 18:22727506-22727528
Sequence AAATTCTGCTTCACTAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155112243_1155112246 20 Left 1155112243 18:22727506-22727528 CCTATCTTAGTGAAGCAGAATTT No data
Right 1155112246 18:22727549-22727571 AACGAGATTACGGAGCAGACTGG No data
1155112243_1155112244 10 Left 1155112243 18:22727506-22727528 CCTATCTTAGTGAAGCAGAATTT No data
Right 1155112244 18:22727539-22727561 CAGCAACCAAAACGAGATTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155112243 Original CRISPR AAATTCTGCTTCACTAAGAT AGG (reversed) Intergenic