ID: 1155113255

View in Genome Browser
Species Human (GRCh38)
Location 18:22737326-22737348
Sequence GGGTTTCAGTCTTCTGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155113255_1155113259 -2 Left 1155113255 18:22737326-22737348 CCATATGCAGAAGACTGAAACCC No data
Right 1155113259 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
1155113255_1155113257 -3 Left 1155113255 18:22737326-22737348 CCATATGCAGAAGACTGAAACCC No data
Right 1155113257 18:22737346-22737368 CCCCTAAAAACAAACCTCCGTGG No data
1155113255_1155113265 17 Left 1155113255 18:22737326-22737348 CCATATGCAGAAGACTGAAACCC No data
Right 1155113265 18:22737366-22737388 TGGGAAGCAGTGCCAAGGTAGGG No data
1155113255_1155113264 16 Left 1155113255 18:22737326-22737348 CCATATGCAGAAGACTGAAACCC No data
Right 1155113264 18:22737365-22737387 GTGGGAAGCAGTGCCAAGGTAGG No data
1155113255_1155113262 12 Left 1155113255 18:22737326-22737348 CCATATGCAGAAGACTGAAACCC No data
Right 1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155113255 Original CRISPR GGGTTTCAGTCTTCTGCATA TGG (reversed) Intergenic
No off target data available for this crispr