ID: 1155113258

View in Genome Browser
Species Human (GRCh38)
Location 18:22737347-22737369
Sequence CCCACGGAGGTTTGTTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155113258_1155113262 -9 Left 1155113258 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
Right 1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG No data
1155113258_1155113269 25 Left 1155113258 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
Right 1155113269 18:22737395-22737417 GAACATCACTGATGAGTGGCTGG No data
1155113258_1155113267 21 Left 1155113258 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
Right 1155113267 18:22737391-22737413 ACCTGAACATCACTGATGAGTGG No data
1155113258_1155113264 -5 Left 1155113258 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
Right 1155113264 18:22737365-22737387 GTGGGAAGCAGTGCCAAGGTAGG No data
1155113258_1155113265 -4 Left 1155113258 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
Right 1155113265 18:22737366-22737388 TGGGAAGCAGTGCCAAGGTAGGG No data
1155113258_1155113270 28 Left 1155113258 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
Right 1155113270 18:22737398-22737420 CATCACTGATGAGTGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155113258 Original CRISPR CCCACGGAGGTTTGTTTTTA GGG (reversed) Intergenic
No off target data available for this crispr