ID: 1155113262

View in Genome Browser
Species Human (GRCh38)
Location 18:22737361-22737383
Sequence CTCCGTGGGAAGCAGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155113258_1155113262 -9 Left 1155113258 18:22737347-22737369 CCCTAAAAACAAACCTCCGTGGG No data
Right 1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG No data
1155113260_1155113262 -10 Left 1155113260 18:22737348-22737370 CCTAAAAACAAACCTCCGTGGGA No data
Right 1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG No data
1155113256_1155113262 -8 Left 1155113256 18:22737346-22737368 CCCCTAAAAACAAACCTCCGTGG No data
Right 1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG No data
1155113255_1155113262 12 Left 1155113255 18:22737326-22737348 CCATATGCAGAAGACTGAAACCC No data
Right 1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155113262 Original CRISPR CTCCGTGGGAAGCAGTGCCA AGG Intergenic
No off target data available for this crispr