ID: 1155116702

View in Genome Browser
Species Human (GRCh38)
Location 18:22775984-22776006
Sequence CACTGGTGGTACTCAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155116693_1155116702 16 Left 1155116693 18:22775945-22775967 CCAAAAATGGAATGGGCAACCTC No data
Right 1155116702 18:22775984-22776006 CACTGGTGGTACTCAAGCCCAGG No data
1155116694_1155116702 -3 Left 1155116694 18:22775964-22775986 CCTCATAGTTCCCTACCCCTCAC No data
Right 1155116702 18:22775984-22776006 CACTGGTGGTACTCAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155116702 Original CRISPR CACTGGTGGTACTCAAGCCC AGG Intergenic
No off target data available for this crispr