ID: 1155130841

View in Genome Browser
Species Human (GRCh38)
Location 18:22933334-22933356
Sequence CGTCGCGCGGGCTCCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155130829_1155130841 30 Left 1155130829 18:22933281-22933303 CCGCGATGGGCAGCTGGAGGAAG No data
Right 1155130841 18:22933334-22933356 CGTCGCGCGGGCTCCCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155130841 Original CRISPR CGTCGCGCGGGCTCCCGGGC GGG Intronic