ID: 1155130987

View in Genome Browser
Species Human (GRCh38)
Location 18:22933960-22933982
Sequence TTCAGGGGTCCTCTTATGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155130987 Original CRISPR TTCAGGGGTCCTCTTATGGG CGG (reversed) Exonic
901152915 1:7116049-7116071 ATGAGGGGTCATCTTATGTGAGG - Intronic
901214633 1:7548745-7548767 TGCAGGGTTCCTCTTAGAGGTGG + Intronic
901214803 1:7549231-7549253 TGCAGGGTCCCTCTTAGGGGTGG + Intronic
901655340 1:10766087-10766109 TTCTGGGGCCCTGTTCTGGGTGG - Intronic
902919434 1:19657354-19657376 TTCAGGGCTCTTTTTTTGGGGGG + Exonic
908379418 1:63581656-63581678 TTCATGGGTCCACTTATATGTGG + Intronic
916083550 1:161252168-161252190 CTGAGAGGTCCTCTTGTGGGAGG - Intergenic
919588768 1:199472803-199472825 TTGAATGGTCCTATTATGGGAGG + Intergenic
920358839 1:205397696-205397718 CTCAAGGGTGCTCATATGGGAGG + Intronic
924335285 1:242981356-242981378 TTCATGGGTCCACTTATAAGTGG - Intergenic
1066957679 10:42188467-42188489 TTCAGCCGTCCACTTTTGGGTGG - Intergenic
1067169059 10:43890979-43891001 TACAGGGGTCCACTTATATGTGG + Intergenic
1067802609 10:49369514-49369536 TGCAGGAGTCCTCTTCTGTGAGG + Intronic
1068511263 10:57968609-57968631 TTCAGGGGTCCTCGAAAGGCTGG + Intergenic
1072715923 10:97752682-97752704 TGCTGGGATCCTCTTGTGGGGGG + Intronic
1074590374 10:114807178-114807200 TGCAGGAGTCCTCTTCTGGTTGG - Intergenic
1074632465 10:115273649-115273671 TTCAGCAGTCCTTTTTTGGGTGG + Intronic
1078630824 11:13002300-13002322 TTCAGCTGTTCTCTTATTGGTGG + Intergenic
1082954362 11:58853263-58853285 TGCATGGGTCCACTTATGGTTGG + Intronic
1082971410 11:59025903-59025925 TGCATGGGTCCACTTATGGTTGG + Intronic
1083749840 11:64754918-64754940 CTCAGGGGTCCCGGTATGGGTGG - Intronic
1085965839 11:81525040-81525062 TTCAGGGCTTTTGTTATGGGTGG + Intergenic
1087094488 11:94306357-94306379 ATCAGGGTTCCTCTTATGTAGGG + Intronic
1088746200 11:112806976-112806998 TTCAAGGGTCCTGACATGGGTGG + Intergenic
1089586658 11:119513791-119513813 TTCAGGGGCCCTCCTGGGGGAGG + Intergenic
1089908138 11:122066474-122066496 TTCTGGGAGCCTCTTTTGGGGGG + Intergenic
1090653886 11:128827837-128827859 TTCTGGGGTTTTCTTATGGTAGG - Intergenic
1101650240 12:106671077-106671099 TTCAGGGGTCATTTTAGGTGTGG - Intronic
1107478720 13:40766806-40766828 TTAAGTGGTCTTCTTTTGGGGGG + Exonic
1108757189 13:53517964-53517986 GCCAGGGGTTCTCTTATGGAAGG - Intergenic
1112016709 13:95337205-95337227 TTTAGGGGACCGCTTCTGGGAGG + Intergenic
1117464882 14:55982961-55982983 ATCTGGGGACCTCTTTTGGGAGG + Intergenic
1118134541 14:63008296-63008318 TTCAGGGGCCCTCATTTGAGTGG - Intronic
1118391805 14:65302178-65302200 TTCAGGTGTGCTCTGATAGGAGG - Intergenic
1120804242 14:88728681-88728703 TGCATGGGTCCACTTATAGGTGG - Intronic
1122323125 14:100867293-100867315 TGCCGGGCTCCTGTTATGGGAGG + Intergenic
1202935425 14_KI270725v1_random:83309-83331 TTCAGCTGTCCACTTTTGGGCGG + Intergenic
1127762212 15:62150289-62150311 TTCAAGGGCCCCCTTATGGGCGG - Intergenic
1131111948 15:89770077-89770099 TTAAGGGGTCCACTTCTGGATGG - Intronic
1133734363 16:8602841-8602863 TTCAGGGGGCCTGAAATGGGAGG - Intergenic
1136484689 16:30563896-30563918 TTTAGGGGTCATGTAATGGGGGG + Intergenic
1144061236 17:11584465-11584487 TTCAGGTGTCCCCTGATGGGAGG - Intergenic
1145894907 17:28450236-28450258 TTCAAATGTCCTCCTATGGGGGG + Intergenic
1147474543 17:40697815-40697837 TTCAGGAGTCCTTTTATTGCCGG - Intergenic
1148862394 17:50611435-50611457 CTCAGGGGTTCTCTCTTGGGTGG - Intronic
1151860845 17:76760438-76760460 TTCAGGGGTCCACTTCTGTGCGG - Intronic
1151990923 17:77573405-77573427 TTCAGGGGTCCTCCTTCTGGTGG - Intergenic
1155130987 18:22933960-22933982 TTCAGGGGTCCTCTTATGGGCGG - Exonic
1157554786 18:48606388-48606410 TTCCAGGGTCCCCATATGGGAGG + Intronic
1157883077 18:51340758-51340780 TTCATAGGTCGTGTTATGGGTGG - Intergenic
1160688770 19:450553-450575 CTCTGGGGACCTCTGATGGGTGG + Intronic
1164063907 19:21697498-21697520 TTCAGGAGTCCTTTTATTGCCGG + Intergenic
1165273189 19:34727718-34727740 TTCAGGAGTCCTTTTATTGCTGG - Intergenic
1166433878 19:42750849-42750871 TTCAGGGGTCCTTTTTTGAAAGG + Intronic
1166437009 19:42776185-42776207 TTCAGGGGTCCTTTTGTGAAAGG + Intronic
1166446726 19:42864625-42864647 TTCAGGGGTCCTTTTTTGAAAGG + Intronic
1166456137 19:42941586-42941608 TTCAGGGGTACTTTTTTGAGAGG + Intronic
1166828086 19:45621675-45621697 TTCAGGGGTCAGCATAGGGGTGG - Intronic
1168549285 19:57280009-57280031 GTCAGGCGTCCTCCTTTGGGTGG + Intergenic
926810337 2:16750291-16750313 TGCAGCTGTCCTCTTTTGGGTGG + Intergenic
926976202 2:18519405-18519427 TCCAGTGATCCTCTTTTGGGAGG + Intergenic
933798466 2:85940782-85940804 ATCAGGGCTCCTTTGATGGGCGG + Intergenic
934305798 2:91820981-91821003 TTCAGCTGTCCACTTTTGGGCGG - Intergenic
934327458 2:92031761-92031783 TTCAGCTGTCCACTTTTGGGCGG + Intergenic
934465844 2:94262341-94262363 TTCAGCTGTCCACTTTTGGGCGG + Intergenic
935534793 2:104281650-104281672 TACTGGGGTCCACTTGTGGGGGG - Intergenic
937236686 2:120435549-120435571 TTCTGGGAGCCTCTTGTGGGTGG - Intergenic
937776285 2:125780282-125780304 TTCAGGAGTACCCTTAGGGGAGG - Intergenic
938170993 2:129076577-129076599 CTCAGGGGTGCTCTGATTGGAGG + Intergenic
938378717 2:130824984-130825006 TTCAGGGGTCACCTTGTGGTGGG + Intergenic
940882330 2:158959239-158959261 TGCAGGGATCTTCTTGTGGGAGG + Intergenic
941977487 2:171421658-171421680 TTCATGGGTCCACTTATATGAGG + Intronic
943006941 2:182396214-182396236 TGCAGCTGTCCTCTTTTGGGTGG - Intronic
943995853 2:194764643-194764665 TTCAGGTGTACTCTCATTGGAGG + Intergenic
946787363 2:223261860-223261882 TTTGGGGGCCCTCTTCTGGGTGG + Intergenic
947130063 2:226913125-226913147 TTCAGTGTTCCTCTTTTGGCTGG + Intronic
1168987911 20:2066216-2066238 TTCAGGGATGCTTTTATGGAAGG - Intergenic
1171524293 20:25797213-25797235 TCCAGGTTTCCTCTCATGGGTGG - Intronic
1171531943 20:25858866-25858888 TTCAGGTGTCCTGTAAAGGGCGG - Intronic
1171552534 20:26058670-26058692 TCCAGGTTTCCTCTCATGGGTGG + Intergenic
1176334692 21:5585036-5585058 TTCAGTGGTCCTCTTTTGCAGGG + Intergenic
1176393065 21:6235912-6235934 TTCAGTGGTCCTCTTTTGCAGGG - Intergenic
1176468354 21:7080262-7080284 TTCAGTGGTCCTCTTTTGCAGGG + Intronic
1176491915 21:7462040-7462062 TTCAGTGGTCCTCTTTTGCAGGG + Intergenic
1176508727 21:7676343-7676365 TTCAGTGGTCCTCTTTTGCAGGG - Intergenic
1176596845 21:8705545-8705567 TTCAGCTGTCCACTTTTGGGCGG + Intergenic
1177704743 21:24688002-24688024 TTCAGGAATGCTCTGATGGGAGG - Intergenic
1178463109 21:32821002-32821024 TTCAGTGTTACTCTTAAGGGCGG - Intergenic
1180279765 22:10682987-10683009 TTCAGCTGTCCACTTTTGGGCGG + Intergenic
1184794461 22:46723679-46723701 TTCAAGGGTCCACTAATGTGGGG + Intronic
953125286 3:40086772-40086794 TTCAGGGGACCTCTAATGAATGG + Intronic
953611512 3:44451028-44451050 TCCAGGAGTCCTCTACTGGGGGG - Intronic
959203604 3:103278861-103278883 TTCAGCTGTCCACTTTTGGGTGG + Intergenic
961710928 3:128827632-128827654 TGCAGCTGTCCACTTATGGGTGG + Intergenic
969206800 4:5653292-5653314 TTCAGGGTTGCTGTCATGGGTGG - Intronic
974785804 4:66618756-66618778 TGCAGGGATCCTAATATGGGGGG - Intergenic
975523684 4:75326877-75326899 TTCAGGTGGCCTATTTTGGGAGG - Intergenic
979241829 4:118453932-118453954 TTCATGGGTCCACTTATAAGTGG + Intergenic
987154969 5:15079903-15079925 ATCAGGGTTCCTCCTATGGTCGG - Intergenic
987752820 5:22064069-22064091 TTCAGGGGTCCACTTATATGTGG + Intronic
989171028 5:38470266-38470288 TTGAGGAGACCTCTTATGAGAGG - Intergenic
990034241 5:51300216-51300238 TTCAGGAGGAGTCTTATGGGAGG - Intergenic
990946639 5:61256286-61256308 TTCAGGAGTCCTCTACTAGGAGG - Intergenic
995830736 5:116352609-116352631 TGCAGGGGTCCACTTATAGATGG - Intronic
1000274159 5:159718072-159718094 TTCAGGTGTCATCCTTTGGGTGG + Intergenic
1005185222 6:23157450-23157472 TGCAGGTGTCCACTTTTGGGTGG - Intergenic
1006931472 6:37691485-37691507 TTCAGGGATCCTTTTGTGTGAGG - Intronic
1012089355 6:94872451-94872473 TTCAGGAGCCCTTTTAGGGGAGG + Intergenic
1012261896 6:97097096-97097118 TTCAGTGGTGCTCATAAGGGAGG + Intronic
1015628358 6:135205120-135205142 TTCTGGGTTCCTCTTATGTCTGG - Intronic
1017957403 6:159190038-159190060 TTCTGGGGTCCTGATAGGGGCGG + Intronic
1018850613 6:167587851-167587873 TTCAGGGGTCATCAGATTGGGGG - Intergenic
1022358251 7:29636419-29636441 TTCAGGAGTCCTTTTATTGCCGG + Intergenic
1025970882 7:66324268-66324290 TTCAGAGTTACTCTTATTGGAGG + Intronic
1031833053 7:126650399-126650421 TACAGCTGTCCTCTTTTGGGTGG - Intronic
1032476210 7:132213162-132213184 TGCAGGGTTCCACTTGTGGGAGG + Intronic
1032991937 7:137403468-137403490 TTCAGGTGTCCTCTTGATGGTGG + Intronic
1034089506 7:148351046-148351068 TTCAGGGGGCTTCTTATTCGTGG + Intronic
1034504518 7:151476819-151476841 TTCATGTCTCCTCTTATCGGGGG - Intronic
1035191719 7:157175329-157175351 ATCAGGAGTCCTCTTTTGGCTGG - Intronic
1046337493 8:112808835-112808857 TTCAGGAGTCCTTTTATTGCTGG - Intronic
1051908543 9:22126193-22126215 TTCAAGGGTTCACTTATAGGTGG - Intergenic
1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG + Intergenic
1058492184 9:105515005-105515027 TTCAGAGGTCCCCTTACTGGAGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062084360 9:134641328-134641350 TTCAGAGCTCCTCTTCTGGGTGG - Intergenic
1203426946 Un_GL000195v1:49884-49906 TTCAGTGGTCCTCTTTTGCTGGG - Intergenic
1192155005 X:68738209-68738231 TTCAGGAGTTCTTTTAGGGGAGG - Intergenic
1194258904 X:91670010-91670032 TTCAGGGAGCTTCTTCTGGGTGG + Intergenic
1195884108 X:109622492-109622514 TTCAGGGGTGACCTTATGGCTGG + Intergenic
1200577607 Y:4909207-4909229 TTCAGGGAGCTTCTTCTGGGTGG + Intergenic
1200973080 Y:9177321-9177343 TTCAGCTGTCCACTTTTGGGTGG + Intergenic
1201056350 Y:9995973-9995995 TTCAGAGATGCTCTTATGTGGGG + Intergenic
1202137999 Y:21687184-21687206 TTCAGCTGTCCACTTTTGGGTGG - Intergenic
1202389538 Y:24355757-24355779 TTCATGGGTCCACTTATAAGTGG + Intergenic
1202481246 Y:25314357-25314379 TTCATGGGTCCACTTATAAGTGG - Intergenic