ID: 1155136492

View in Genome Browser
Species Human (GRCh38)
Location 18:22999313-22999335
Sequence AGTTGTAGGCAGATGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 7, 3: 53, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155136492 Original CRISPR AGTTGTAGGCAGATGGTGGC TGG Intronic
900674530 1:3876741-3876763 AGGTGCAGGCAGCAGGTGGCAGG - Intronic
901124907 1:6922425-6922447 TGTTGCAGTCAGATAGTGGCTGG + Intronic
901779997 1:11587626-11587648 GCTTATAGCCAGATGGTGGCTGG - Intergenic
902073486 1:13762873-13762895 AGCTGCAGGCAGGAGGTGGCTGG + Intronic
903016490 1:20365405-20365427 AGTGAGAGGCAGATGATGGCTGG - Intergenic
903333971 1:22612829-22612851 AGGTGGTGGCAGATGGTGGGTGG - Intergenic
904820183 1:33237656-33237678 AGTCGTTGGCAGAGGATGGCTGG + Intergenic
904995094 1:34625591-34625613 AGTTGGAGGAAGGAGGTGGCTGG - Intergenic
905204501 1:36335513-36335535 AGTTGTGGACAGTTGGAGGCTGG - Intergenic
905326207 1:37153699-37153721 AGTTGAAGGCAGATGATGCAGGG + Intergenic
905399175 1:37689639-37689661 AGGCGTAAGCAGCTGGTGGCTGG - Exonic
905735074 1:40319324-40319346 GGTCATAGTCAGATGGTGGCTGG + Intergenic
907143515 1:52210983-52211005 AGTTGTAGTCAGACAGTGGCTGG + Intronic
907952864 1:59200807-59200829 AGTTGCAGTCAGATGTTGGCTGG + Intergenic
908428919 1:64036845-64036867 GGTTGCAGTCAGATGGTGGCTGG + Intronic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
912179663 1:107204572-107204594 GATTGTATTCAGATGGTGGCTGG - Intronic
915543620 1:156583626-156583648 AATTCTGGGCAGGTGGTGGCAGG + Intronic
916037082 1:160931954-160931976 GGTTGCAGTCACATGGTGGCTGG + Intergenic
916122555 1:161541665-161541687 AGTTGTGGTGAGATGGTTGCTGG + Intergenic
916593713 1:166221013-166221035 ACTTGAAGGCAGAAGGTGGGAGG - Intergenic
918060774 1:181059499-181059521 AGTTGGAGGCAAGTGGTGGCTGG + Exonic
918410455 1:184253339-184253361 TGTTGCAGTCAGATGATGGCTGG - Intergenic
919793220 1:201305699-201305721 AGTTGGAGGGAGAGGCTGGCTGG - Intronic
920977145 1:210796958-210796980 AGCACTAGGCAGATCGTGGCAGG - Intronic
921857228 1:220000032-220000054 GGTTTCAGTCAGATGGTGGCTGG - Intronic
924638459 1:245810556-245810578 AGTTGAAGGCTGGTGGGGGCAGG + Intronic
1064667758 10:17674386-17674408 AGTTGTAGTCACATAGTGCCTGG + Intronic
1065558770 10:26941752-26941774 AGTTGTAGGGCAATGGTGGAAGG - Intergenic
1067051906 10:43026456-43026478 AGTTGTTGGGTGATGGTGCCAGG - Intergenic
1068656155 10:59578094-59578116 AGTAGTAAGCAGATGGTAGAGGG + Intergenic
1069065858 10:63941343-63941365 AGCTGGATGCAGATTGTGGCTGG + Intergenic
1069586506 10:69607604-69607626 AGCTATAGGCAGGTGGTGGGGGG - Intergenic
1069841918 10:71345312-71345334 AGTTGCAGTCAGATGGCAGCTGG + Intronic
1069955252 10:72046493-72046515 AGTTGTAGTCAGATGGAGGCTGG + Intergenic
1071226784 10:83539695-83539717 AGCTGTGGGCAGCTGGGGGCAGG + Intergenic
1071301386 10:84258413-84258435 AGTTGTAGGTGGAGGGTGACCGG + Intronic
1071334039 10:84587148-84587170 AGAAGGAGGCAGATGGTGGCTGG + Intergenic
1073731466 10:106293278-106293300 AGTTGTAGGAACATAGTGGATGG - Intergenic
1075025414 10:118980167-118980189 AGCTGCAGGATGATGGTGGCTGG + Intergenic
1075431586 10:122387653-122387675 AGTTGCAGTCAGATGGCAGCTGG + Intronic
1076121399 10:127939778-127939800 AGGTGCAGGCAGATGTGGGCAGG + Intronic
1076121402 10:127939788-127939810 AGATGTGGGCAGGTGGAGGCAGG + Intronic
1076121412 10:127939838-127939860 AGGTGCAGGCAGATGTGGGCAGG + Intronic
1076121415 10:127939848-127939870 AGATGTGGGCAGGTGGAGGCAGG + Intronic
1076121424 10:127939898-127939920 AGATGCAGGCAGATGTAGGCAGG + Intronic
1076121427 10:127939908-127939930 AGATGTAGGCAGGTGGAGGCAGG + Intronic
1076121453 10:127940028-127940050 AGATGTGGGCAGATGGAGGCAGG + Intronic
1076479019 10:130772234-130772256 AGATGTGGCCAGATGCTGGCGGG + Intergenic
1076615103 10:131749870-131749892 AGCTGTGGGGAGGTGGTGGCAGG - Intergenic
1077212420 11:1377684-1377706 AGTTGCAAGCAGATGGGGGATGG + Intergenic
1077969346 11:7171586-7171608 ACTACTAGGCAGATGGTGACTGG - Intergenic
1080478406 11:32620219-32620241 AGTTGGTGGCAGCTGTTGGCTGG + Intronic
1080774298 11:35371391-35371413 TGTAGTTGACAGATGGTGGCAGG - Intronic
1081334016 11:41842247-41842269 AACTCTAGGCAGACGGTGGCAGG + Intergenic
1081617227 11:44598033-44598055 ACTGGAAGCCAGATGGTGGCAGG - Intronic
1081722114 11:45297758-45297780 AGTTGTATTCAAATAGTGGCAGG - Intergenic
1084984173 11:72852985-72853007 ACTTGAAGGCAGAAGGTGGGAGG + Intronic
1087135209 11:94709676-94709698 AGTTGCAGTCAGATAGTGGTGGG - Intronic
1087592475 11:100208655-100208677 AATTGTGGGCAGATGGTGGTAGG - Intronic
1088011472 11:105006642-105006664 AGTTGTTGGCATGTGGTGCCTGG + Intronic
1089078230 11:115756077-115756099 AGCTGTAGTCCCATGGTGGCAGG + Intergenic
1090010896 11:123045216-123045238 AGATGCAGTCAGCTGGTGGCTGG + Intergenic
1090158050 11:124462703-124462725 AGTTGTGGGCAGACAGTGGAAGG - Intergenic
1090194702 11:124804774-124804796 GGTTGTCGTCAGCTGGTGGCTGG - Intergenic
1092824385 12:12384800-12384822 AGCTGCAGTCAGTTGGTGGCTGG + Intronic
1093785573 12:23188272-23188294 GGTTGCAGTCAGATGGTAGCAGG - Intergenic
1096165128 12:49416272-49416294 AGTTGGAGATAGATGGTAGCTGG + Intronic
1096743774 12:53712674-53712696 AGTTGTAGCCAGATGGATGCTGG + Intronic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1098183664 12:67874694-67874716 GGCTGTAGTCAGATGGTGGCTGG - Intergenic
1098220029 12:68259620-68259642 CTTTGTGGGCAGATTGTGGCAGG - Intergenic
1098385135 12:69910405-69910427 AGGTGGAGGGAGAAGGTGGCAGG + Intronic
1100605950 12:96152312-96152334 AGTTGCAGTGAGAAGGTGGCTGG - Intergenic
1101433753 12:104647797-104647819 GGCTGTAGTCAGATGTTGGCTGG + Intronic
1101584173 12:106070181-106070203 AGTTGTAAGCAGATGGCAGTTGG - Intronic
1102190330 12:110982929-110982951 GGTTGCAGTCAGCTGGTGGCAGG - Intergenic
1103285708 12:119799603-119799625 ATTTGTGGGAAGATGGTGTCTGG - Intronic
1104410901 12:128556833-128556855 AGTTGCTGTCAGATAGTGGCAGG - Intronic
1105972733 13:25445708-25445730 AGATGGTGGTAGATGGTGGCTGG + Intronic
1108086866 13:46803065-46803087 AGTTGAAGTCAGATGGTTGGAGG + Intergenic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109269205 13:60235583-60235605 AGTTGCAGTCAGATGGTGGCTGG - Intergenic
1109715605 13:66218199-66218221 GGTTGTAGTCAGTTGGTGGCTGG + Intergenic
1112171332 13:96975768-96975790 TGTTGTAGGCAGTTAGTGGAGGG + Intergenic
1112343457 13:98571371-98571393 AGTTATGGGCAGGTGGCGGCTGG - Intronic
1112820334 13:103326877-103326899 TATTGGAGTCAGATGGTGGCTGG - Intergenic
1113586552 13:111469857-111469879 AGTTGTGAGCAGATTGGGGCTGG + Intergenic
1115628547 14:35219954-35219976 AGTTGTGAGAAGATGGCGGCAGG - Intronic
1115876472 14:37867410-37867432 ACTTGCAGGCAAGTGGTGGCTGG + Intronic
1117942670 14:60985169-60985191 ACTAGCAGGCAGATGGGGGCAGG - Intronic
1118252189 14:64172321-64172343 AGTTGCAGTCAGATGGTGGCTGG + Intronic
1118312737 14:64705236-64705258 AGGTCGAGGCAGCTGGTGGCCGG - Intronic
1119229536 14:72969385-72969407 AGCTGGAGACAGATGGTGGCTGG + Intergenic
1119718765 14:76877025-76877047 AGTTGTATTCAGAAGGTGTCTGG - Intergenic
1120227122 14:81803348-81803370 ATTTGTAGACAGATGGAAGCTGG - Intergenic
1120858276 14:89231818-89231840 AGATGGAAGCAGGTGGTGGCGGG + Intronic
1121209041 14:92192900-92192922 AGTTGTAATCAAATGTTGGCTGG - Intergenic
1121438103 14:93932126-93932148 GGTTGTGGGAAGATGGGGGCAGG + Intergenic
1121468625 14:94133561-94133583 GGTAGAAGGCAGCTGGTGGCCGG - Intergenic
1122054080 14:99080580-99080602 AGTTGCAGTTAGTTGGTGGCTGG - Intergenic
1122564648 14:102644081-102644103 AGTTGTGTTCACATGGTGGCTGG + Intronic
1123121169 14:105917810-105917832 AGTTGTGGGCAGGAGGAGGCAGG + Intergenic
1123685664 15:22795387-22795409 AGCTGCAAGCAGATGGTGGCTGG + Intronic
1124247049 15:28079836-28079858 AGGTGCAGGCACATGGGGGCAGG - Intronic
1126063997 15:44811185-44811207 AGTTGTTGACAGATGGTAGTGGG + Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126686968 15:51256896-51256918 AGGTGTAGTCAGATGATGGGTGG + Intronic
1127362891 15:58260562-58260584 AGTTTTAGGAAGATGGGGACTGG - Intronic
1127769549 15:62220038-62220060 AGTGGTAGTCAGCTGGTGGTAGG - Intergenic
1130399005 15:83531537-83531559 AGTGGCAGGCAGATCGTGGAAGG + Intronic
1130925695 15:88384012-88384034 AGTTGAAGAAAGATGGTGGTGGG - Intergenic
1131666792 15:94579511-94579533 AGTGGCAGGCAGATGGAGGAAGG + Intergenic
1132540230 16:504987-505009 AGTTGTAGGGAGGAGGTGGTGGG - Intronic
1134564769 16:15241655-15241677 AGTTGTAGTCAGATAATGACTGG - Intergenic
1134737729 16:16515044-16515066 AGTTGTAGTCAGATAATGACTGG + Intergenic
1134817567 16:17218671-17218693 ATTTGGAGGGAGATGGGGGCCGG - Intronic
1134929773 16:18197115-18197137 AGTTGTAGTCAGATAATGACTGG - Intergenic
1135165120 16:20132221-20132243 AGTTGCAGTTAGATGTTGGCTGG - Intergenic
1135219299 16:20599706-20599728 AATTTTTGGCAGATGGTGGTTGG - Intergenic
1135497919 16:22968857-22968879 AGTTGTAGGTAGGTGGCAGCTGG - Intergenic
1136540579 16:30925710-30925732 GGCTGTAGGTGGATGGTGGCAGG - Exonic
1136733039 16:32436212-32436234 AGAAGTAGGCAGATGATGACAGG - Intergenic
1139272986 16:65700682-65700704 AGTGGTATTCAGCTGGTGGCTGG - Intergenic
1139657709 16:68399105-68399127 AGGTGTAGGCAGAGGCTGGGCGG - Intronic
1140538456 16:75733007-75733029 AGTTCTGGCCAGATGGTGCCAGG + Intronic
1203020042 16_KI270728v1_random:393391-393413 AGAAGTAGGCAGATGATGACAGG + Intergenic
1203038377 16_KI270728v1_random:666549-666571 AGAAGTAGGCAGATGATGACAGG + Intergenic
1142637203 17:1265283-1265305 AGTTGTCGGCAGGTGCTGGATGG + Intergenic
1142747994 17:1969905-1969927 GGTTGCAGTCAGATGGTGGCAGG + Intronic
1143903712 17:10193785-10193807 AGTTGCAATCAGATGGTGGCTGG - Intronic
1144245112 17:13355390-13355412 GGTTGTTGGTAGATGGTGGATGG + Intergenic
1144930455 17:18854970-18854992 AGTTGCAGTCAGGTGGTGGCTGG + Intronic
1145221948 17:21096749-21096771 AGTTGCAGGGAGATAGGGGCTGG + Intergenic
1145959146 17:28876306-28876328 ACATGCAGCCAGATGGTGGCTGG + Intergenic
1146822746 17:35997894-35997916 AGGTGTGGGCAGATGGAGACAGG + Intronic
1147343688 17:39772185-39772207 AGTTGAAGACAGATTGTGGAGGG + Intronic
1147933319 17:43996337-43996359 GGTTGCAGTCAGATGATGGCTGG - Intronic
1148044420 17:44733947-44733969 ATGTGTAGCCAGAAGGTGGCAGG + Intronic
1148052878 17:44777791-44777813 AGTTGAAGGCAGAAGCTGGCAGG - Exonic
1149954409 17:61032409-61032431 AGTTTTGGGAAGATGGTGGCTGG - Intronic
1150629624 17:66870217-66870239 AGGTGCAGTCAGATGTTGGCTGG + Intronic
1150928252 17:69556868-69556890 ATGTGTTGTCAGATGGTGGCTGG + Intergenic
1150930887 17:69584020-69584042 AGATGTAGGTAGATGTTGGACGG - Intergenic
1153607690 18:6851136-6851158 AGTTGTGGGGGGATGGTGGTAGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1155121941 18:22830036-22830058 CGTGGTAGTCAGATGGTGGCAGG - Intronic
1155136492 18:22999313-22999335 AGTTGTAGGCAGATGGTGGCTGG + Intronic
1155231176 18:23776646-23776668 AGTTGTGGGGACATGGGGGCAGG + Intronic
1155949709 18:31897992-31898014 AGTTGCAGGGAGATGGTTCCAGG + Intronic
1156567332 18:38208181-38208203 AGTTGAAGGCAGAGGGCAGCAGG - Intergenic
1156650677 18:39223121-39223143 AGTTGTAGTCAGACAATGGCTGG - Intergenic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1158639617 18:59192481-59192503 AGTTGTAATCAGATGCTGGCTGG - Intergenic
1159249525 18:65856179-65856201 GGTTGTAGTCAAATGTTGGCTGG - Intronic
1159434401 18:68397377-68397399 AGATCAAGGCAGATGCTGGCAGG + Intergenic
1160855279 19:1214544-1214566 TGGTGTCGGCAGGTGGTGGCCGG + Intronic
1160922810 19:1528727-1528749 AGGTGTGGGCAGGTGGGGGCAGG - Intronic
1162784126 19:13023575-13023597 GGTTGTGGGGAGATGGTGGGAGG + Intronic
1164661598 19:29976339-29976361 GGTTGCAGCCAGTTGGTGGCTGG + Intronic
1164824987 19:31278396-31278418 AGTTTTGGGGAGATGCTGGCAGG + Exonic
1165149820 19:33753865-33753887 AGTGGTAGGAGGATGGTGGGTGG - Intronic
1165714815 19:38037473-38037495 AGGTGGGGGCAGATGGTGCCGGG + Intronic
1166377526 19:42336062-42336084 AGCTGGAGGCAGGTGGTGCCAGG - Exonic
1167338013 19:48898453-48898475 AGTTCTAGGCCGCTGGGGGCTGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926859664 2:17295549-17295571 GGTTGTAGCCAGATAGTGGCTGG - Intergenic
927104405 2:19811167-19811189 GATTGAAGGAAGATGGTGGCAGG - Intergenic
929326182 2:40614143-40614165 AGGTGCTGGCAGATGGTGTCTGG + Intergenic
930943629 2:57044589-57044611 AGTTGTAGGCAACTAGAGGCAGG - Intergenic
932136251 2:69231645-69231667 AGCTGCAGTCAGATGGCGGCTGG + Intronic
932803915 2:74766934-74766956 AGTTGCAGTCAGGTGGTGGCTGG - Intergenic
932888933 2:75573653-75573675 ACTTGTAGTCAGTTGTTGGCTGG + Intergenic
932931335 2:76043153-76043175 ACTTGTAGGCAGATGGTGATGGG + Intergenic
934040678 2:88125501-88125523 AGTGGTTGGCAGATGGTGGCAGG - Intronic
935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG + Intergenic
935816002 2:106846141-106846163 GGTTGCAGTCAGATGTTGGCTGG - Intronic
935976876 2:108586902-108586924 AGTGGAAGGCAGATGGAAGCTGG - Intronic
939076566 2:137609554-137609576 AGGTGTAGGCAGATAGTGTAAGG + Intronic
939270952 2:139938730-139938752 AGTTGTTCACAGATGGTGGGGGG + Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
940436705 2:153664854-153664876 GGTTGCAGTCAGATGTTGGCAGG - Intergenic
942528322 2:176880343-176880365 AGTTATAGCCAGATGTTGGTAGG - Intergenic
943139188 2:183957776-183957798 AGTAGTAATCAGCTGGTGGCAGG + Intergenic
944515100 2:200505153-200505175 ATTTGTAAGCAGAGGGTTGCTGG - Intronic
945457481 2:210066267-210066289 AGTTGTAGTAAGATTGTGACTGG - Intronic
946396131 2:219444600-219444622 AGTTGGAGGCAGAGGGAGGAGGG + Intronic
946452923 2:219796381-219796403 AGTTGCAGTCAGATGGTAGCTGG - Intergenic
948475666 2:238217418-238217440 GGTTGTAGTCAGATGTTGGTTGG - Intergenic
948813542 2:240498381-240498403 AGATGTATGCAGATTGTGGTTGG + Intronic
949021128 2:241742061-241742083 AGATGCAGGCAGAGGGTGGAAGG + Intronic
1169479163 20:5962047-5962069 AGTTGTAGTCAGATGGTGGCTGG + Intronic
1169745700 20:8940480-8940502 AGTTGCAATCAGATGTTGGCTGG + Intronic
1170332072 20:15224113-15224135 GGTTGTAGTCAACTGGTGGCTGG - Intronic
1172741057 20:37167564-37167586 AGTTGGTGGCAGAGTGTGGCTGG + Intronic
1173009269 20:39166726-39166748 AGTTGCAGTTACATGGTGGCTGG - Intergenic
1173640429 20:44598051-44598073 AGTTGCAGTTAGATGGTGGCTGG + Intronic
1174430845 20:50467583-50467605 AGTTGTATTCAGGTGGTGGCGGG + Intergenic
1175881504 20:62262096-62262118 AGTTTTAGGCAGAGGGTGACGGG - Intronic
1177573311 21:22918408-22918430 AGTTGTAGGGAGATTCAGGCAGG - Intergenic
1177910033 21:27019509-27019531 ATTTGTAGGTAGATTGTGTCTGG - Intergenic
1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG + Exonic
1179170725 21:38970802-38970824 AATATTAGGAAGATGGTGGCTGG - Intergenic
1179171930 21:38979936-38979958 AGGTGTGGGTAGATGGTGCCTGG - Intergenic
1180282368 22:10714253-10714275 AGTTGAAGGATGATGGTGGTTGG + Intergenic
1180819089 22:18813055-18813077 GGTTGCAGTCAGATAGTGGCTGG - Intergenic
1181013187 22:20054080-20054102 AGTGGTCGGCACATTGTGGCGGG + Intronic
1181205313 22:21247503-21247525 GGTTGCAGTCAGATAGTGGCTGG - Intergenic
1181471454 22:23142797-23142819 GGTTTTATGCAGGTGGTGGCTGG - Intronic
1182078183 22:27509406-27509428 AGTGGTAGGCAGAGAGAGGCTGG - Intergenic
1183053085 22:35280812-35280834 AGATGTAGGCAGATGAAGGGTGG - Intronic
1183511690 22:38239164-38239186 AGGGGCAGGCAGATGGGGGCAGG - Intronic
1184524121 22:45011581-45011603 AGATTCAGGCAGATGCTGGCCGG - Intergenic
1185010883 22:48313355-48313377 AGTTGTGACCAGATGGTGGTTGG - Intergenic
1203221612 22_KI270731v1_random:47912-47934 GGTTGCAGTCAGATAGTGGCTGG + Intergenic
1203269214 22_KI270734v1_random:38908-38930 GGTTGCAGTCAGATAGTGGCTGG - Intergenic
949185527 3:1187446-1187468 AGTTATAGGCCCATGGTGTCAGG + Intronic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949249464 3:1965638-1965660 AAATGAAGGCAGATGGTGTCTGG + Intergenic
950859475 3:16135046-16135068 TGCTGTAGTCAGGTGGTGGCTGG + Intergenic
950876879 3:16283640-16283662 AGTTGTCAGCAGAAGGTGGGAGG + Intronic
950889248 3:16388217-16388239 AGTTGTAGGGAGATGGAGGGGGG - Intronic
951453199 3:22862643-22862665 AGTTCCAGTCAGAAGGTGGCAGG + Intergenic
952189203 3:31004497-31004519 AGTTGCAGGCAGACAGTGGCTGG + Intergenic
952813240 3:37423797-37423819 AGTGGTAGCCAGCTGGTGGCTGG - Intronic
953213917 3:40900056-40900078 AGTTGCAGTCAGATGGTAGATGG + Intergenic
957110292 3:75946968-75946990 AGTTGAAGGATGATGGTGGTTGG + Intronic
959856347 3:111163059-111163081 AGTTACAGTCAGATGGTGGCTGG + Intronic
960803999 3:121565196-121565218 ATTTTGAGGGAGATGGTGGCAGG + Intergenic
961449579 3:126996457-126996479 AGTGCAAGGCAGTTGGTGGCAGG + Intronic
962014075 3:131422644-131422666 AGTTGTAGGGAAATGATGGTAGG + Intergenic
962014177 3:131423461-131423483 GTTTGTATTCAGATGGTGGCTGG - Intergenic
962371560 3:134824926-134824948 GGTTGCAGTCAGATGTTGGCAGG - Intronic
963496186 3:146064457-146064479 GGTTGCAGGCAGATGTTGACAGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964311608 3:155399737-155399759 AGTTGCAGCCAGATGATGGCTGG + Intronic
964383077 3:156118209-156118231 AGTTGCAGTCAGATGTTGGCTGG + Intronic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
967956077 3:194878410-194878432 GGTTGTAGGCAGAAGCTGGAAGG + Intergenic
970285810 4:14513255-14513277 AGTGGTAGTCAGTTGGTGACAGG - Intergenic
970979747 4:22082503-22082525 AGTTGTTGGCAGAAGCAGGCTGG - Intergenic
971396854 4:26236437-26236459 AGTTGCAGTCAGATGTTAGCTGG + Intronic
974026585 4:56738322-56738344 AGTGCTAGGGAGATGATGGCAGG + Intergenic
974359367 4:60856393-60856415 AGATGTGGTCAGAAGGTGGCAGG - Intergenic
975455379 4:74584382-74584404 AGTAGTAGGCAGAGGGAGGGAGG + Intergenic
976060685 4:81124720-81124742 AGTTACAGTCAGATGGTGTCGGG - Intronic
977519446 4:98062293-98062315 AGTTGTAGGTGGAGGGTGGGAGG + Intronic
977602506 4:98949502-98949524 AGTTGTAGCCAGATATTGGTAGG - Intergenic
978243466 4:106544322-106544344 AGTAGCAGTCAGATGGTGGCAGG - Intergenic
978435631 4:108681597-108681619 AGTTGTAGTCAGATGGCAGCTGG - Intergenic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
980015462 4:127645431-127645453 AGTTACAGGCAGATGGTGGTTGG - Intronic
980338435 4:131506809-131506831 AGTTGGAGGCAGATGGAGTCTGG + Intergenic
980517705 4:133886148-133886170 AGTTGTTGGAAGATGGTATCTGG - Intergenic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980888447 4:138788402-138788424 AGTTGCAGTCAGATGATGACAGG + Intergenic
982194683 4:152899136-152899158 ATATGTAGGCAGATGTTGGAGGG - Intronic
983030561 4:162796328-162796350 GGTTGTAGCCAGATGAAGGCTGG + Intergenic
983178668 4:164622307-164622329 AGTTTGAGTCAGATGGTAGCTGG - Intergenic
983361975 4:166737974-166737996 CGATGAAGGCAGATGGTGGCAGG - Intronic
983642369 4:169954922-169954944 AGTTGCCGTCAGATGCTGGCTGG - Intergenic
983890547 4:173025430-173025452 AGTTATTGGCTGATGGGGGCAGG - Intronic
984278933 4:177643830-177643852 AGTTGAAGACAGATGGTGAATGG - Intergenic
984655166 4:182309525-182309547 AGCAGTAGGCAGACGCTGGCAGG - Intronic
986515775 5:8562254-8562276 GGTTATAGTCAGATGGTGCCTGG + Intergenic
986923498 5:12717304-12717326 AGCTGTAGGCAGTTGGGTGCTGG + Intergenic
987218903 5:15769151-15769173 AGAAGGAGGCAGCTGGTGGCAGG - Intronic
989215981 5:38905073-38905095 AGTTGGAGGGAGATGGAAGCAGG - Intronic
989739642 5:44755616-44755638 GCTTGTGGTCAGATGGTGGCTGG - Intergenic
990285912 5:54300450-54300472 AGTTGTAATCAGATGGAGGGTGG - Intronic
990525121 5:56617837-56617859 AGTTGCAGGCAGGTGTTGGCTGG - Intergenic
991001845 5:61790934-61790956 TGTTGTGGGCAGATGGTGGCTGG - Intergenic
992198971 5:74365816-74365838 AGTTGAAGTCAGTTGGTGGTGGG + Intergenic
992459018 5:76943125-76943147 TGGTGCAGTCAGATGGTGGCTGG + Intergenic
992464643 5:76991723-76991745 GGTTGTAGTCTGATGGTGGCTGG + Intergenic
992986327 5:82234209-82234231 ACTTTTAGGCAGATGGGGGAGGG + Intronic
993451689 5:88078871-88078893 AGTTGAGGGTAGATGGTGGGAGG + Intergenic
993733728 5:91451432-91451454 GGTGGTGGCCAGATGGTGGCTGG + Intergenic
993733933 5:91453322-91453344 GGTGGCAGTCAGATGGTGGCTGG + Intergenic
994007293 5:94853953-94853975 AGACACAGGCAGATGGTGGCAGG + Intronic
994703835 5:103174459-103174481 GGTTGTAGTCAGACAGTGGCTGG + Intronic
995526647 5:113055460-113055482 AGCTGAAGAGAGATGGTGGCTGG + Intronic
995553084 5:113299773-113299795 AGGTGTGGGCAGGAGGTGGCAGG + Intronic
995741056 5:115356108-115356130 AGTTGCAGTCACATGGTGGGTGG - Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
997816341 5:137022356-137022378 GGTTGCAGGCAGATAGTGCCTGG - Intronic
998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG + Intronic
999664825 5:153901749-153901771 GGTTGCAGTCAGATGGTGGCTGG - Intergenic
1001631759 5:173180523-173180545 GGTTGTAGTCAGATGGTAGCTGG - Intergenic
1002436416 5:179234555-179234577 AGTTGCAGGCAGCAGGGGGCGGG - Intronic
1002484541 5:179525030-179525052 ACATGCAGGCAGATGGAGGCAGG + Intergenic
1002992974 6:2254994-2255016 AGTGGTATTCAGATGGTGGCTGG + Intergenic
1006444918 6:34074786-34074808 GTTTGGAGGCAGATGGTGGCAGG + Intronic
1008430183 6:51407134-51407156 AATTGTAGTCAGATGTTGGCTGG - Intergenic
1008736479 6:54550431-54550453 ACTTCTGGCCAGATGGTGGCAGG + Intergenic
1011699112 6:89939325-89939347 AGGTGAAGTCAGATGTTGGCTGG - Intronic
1013082944 6:106828593-106828615 TGCTGGAGGCAGATGATGGCAGG - Intergenic
1013961091 6:115901304-115901326 AGTTGTAGGCAGATCTTGAAGGG - Intergenic
1014276062 6:119390652-119390674 AGTTGCAGTCAGATGGTAGTTGG - Intergenic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1017014808 6:150091478-150091500 AGCTGTAGGCACATGGTAGGTGG - Intergenic
1017027319 6:150192744-150192766 AGCCGGAGTCAGATGGTGGCTGG + Intronic
1017984526 6:159432064-159432086 ATTTGCAGTCAGATGGTGGTTGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019633897 7:2065223-2065245 AGCTGAAGGCAGATGGAGACTGG - Intronic
1019723358 7:2586910-2586932 AGTGTTAGGCAGAGGGTGGAGGG + Intronic
1019760263 7:2806336-2806358 GGGTGTGGGCACATGGTGGCAGG + Intronic
1023760477 7:43461192-43461214 AGTTGCAGTCAGAGGGTGGCCGG + Intronic
1024096939 7:45989499-45989521 AGGTGGAGCCAGTTGGTGGCTGG + Intergenic
1024983336 7:55175490-55175512 AGTGGTGGGAAGATGCTGGCTGG + Intronic
1025865864 7:65380014-65380036 AGTTGAGGGTAGAGGGTGGCAGG - Intronic
1025996637 7:66531511-66531533 AGCTGCAGGGAGCTGGTGGCGGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026201229 7:68216203-68216225 AGTTGAAGGCAGCCAGTGGCAGG + Intergenic
1026434360 7:70382067-70382089 AGTTGTAGGGCAATGGTGTCTGG - Intronic
1026988690 7:74570914-74570936 AGCTGTGGGGAGCTGGTGGCGGG - Intronic
1029116803 7:98241800-98241822 TGCTGTAGGGGGATGGTGGCAGG - Intronic
1030065522 7:105656086-105656108 AGTTGTAGGCTGAGGTGGGCAGG - Intronic
1030907247 7:115201505-115201527 AGTTGCACTCAGATGATGGCTGG + Intergenic
1032491079 7:132325058-132325080 AGGTGAAGGCAGGTGGGGGCAGG - Intronic
1032619293 7:133511528-133511550 ACTTTTAGGCAGATGGGGGAGGG + Intronic
1032665501 7:134032404-134032426 AGCAGCAGGAAGATGGTGGCAGG - Intronic
1032694252 7:134320218-134320240 AGTTGCAGTCAGATGTAGGCTGG + Intergenic
1033532554 7:142279845-142279867 CTTTGCAGGCAGCTGGTGGCTGG - Intergenic
1033885721 7:145942755-145942777 AGATGCAGTCTGATGGTGGCTGG - Intergenic
1034789591 7:153956191-153956213 AGATGTGGGCAGGTGGGGGCTGG + Intronic
1035206243 7:157295585-157295607 AAGTGAAGGCAGATGCTGGCCGG - Intergenic
1035241796 7:157537036-157537058 AGTCGTAGTCAGATGTTGGAGGG - Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1038558393 8:28545623-28545645 AGCTGCAGTCAGATGATGGCTGG - Intronic
1038744239 8:30242733-30242755 GGTTGGAGTCAGATGTTGGCTGG - Intergenic
1042784632 8:72535030-72535052 AGAGGTAGGCAGATGCTGTCTGG + Intergenic
1043097465 8:75993946-75993968 AGTTGTAGGCTGATGGAGCAAGG - Intergenic
1044486505 8:92760866-92760888 AGTTGCAGTCAGATGGTGATTGG + Intergenic
1044707534 8:95023612-95023634 AAGTGTAGGCAGCTGCTGGCTGG + Intronic
1044929438 8:97237854-97237876 AGTTGCAGTCAGATGTTAGCTGG + Intergenic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1047562074 8:125997762-125997784 TGTTGCAGCCAGAAGGTGGCTGG + Intergenic
1049366314 8:142238555-142238577 AGCAGCTGGCAGATGGTGGCAGG - Intronic
1049379552 8:142305229-142305251 AGCTGTGGGCAGAGGGTGCCAGG + Intronic
1049713416 8:144077914-144077936 AGTTGCTGCCAGATGGTAGCTGG - Intergenic
1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG + Intergenic
1051726182 9:20089685-20089707 AGTGGTGGGCAGGGGGTGGCGGG - Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1053291519 9:36882544-36882566 CTTTGAAGGCAGGTGGTGGCAGG - Intronic
1054952419 9:70867373-70867395 AGTTTTAGTCAGATGATGGGTGG + Intronic
1055202882 9:73689090-73689112 ACTTGAAGGCAAATGATGGCAGG - Intergenic
1056232025 9:84556873-84556895 ACTTTTACTCAGATGGTGGCTGG + Intergenic
1057073212 9:92118377-92118399 GGTGGTAACCAGATGGTGGCTGG - Intergenic
1058095966 9:100860726-100860748 TGTTGAAGACAGATGGTTGCAGG + Intergenic
1058450174 9:105089166-105089188 AGTTGCAGTTAGATGGTGGCTGG - Intergenic
1058815128 9:108675947-108675969 AGCTGTTGTCTGATGGTGGCTGG - Intergenic
1061216583 9:129225222-129225244 AGATGGAGGCTGATGGAGGCTGG - Intergenic
1061265769 9:129504122-129504144 AGTTGTAGAAAGATGGGGCCAGG + Intergenic
1061533355 9:131231986-131232008 AGCTGTAGGCAGAGGGTCTCTGG - Intronic
1061974966 9:134063379-134063401 TGGTGTGGGCAGATGGGGGCGGG + Intronic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1186384907 X:9100365-9100387 GGTTGTAGTCAAATGGTGGCTGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187724250 X:22186074-22186096 AGTTACAGTCAGATAGTGGCTGG + Intronic
1187962880 X:24583392-24583414 AGTTGTAATCAGATGTTGGTGGG - Intronic
1188114165 X:26223353-26223375 AGGTGTACTGAGATGGTGGCAGG - Intergenic
1188506204 X:30887892-30887914 AGTTGTAAGCAAGTGGGGGCGGG + Intronic
1189174095 X:38936597-38936619 ATTTGTAGTCAGATGGCAGCTGG - Intergenic
1189233043 X:39466896-39466918 AGTTGCAGTCAGAAGGGGGCTGG - Intergenic
1189815121 X:44817078-44817100 GGTTGCAGTCAGATGGTGGCAGG + Intergenic
1190049923 X:47141977-47141999 AGTTGTAGTTAGATGGTGGCTGG - Intergenic
1192388517 X:70699270-70699292 GGTTGCAGTCAGATAGTGGCTGG - Intronic
1192640255 X:72855613-72855635 AGTTGTAGGCAGAGGGGGATTGG + Intergenic
1192641456 X:72865163-72865185 AGTTGTAGGCAGAGGGGGATTGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194597489 X:95876640-95876662 AGTTGTTGGCAGAGGTTTGCAGG + Intergenic
1195853274 X:109305862-109305884 AATTCTAGGCAGATAGCGGCAGG - Intergenic
1196163461 X:112512102-112512124 AGATGTAGGCAGTTGGTGGCGGG - Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1198844288 X:140893438-140893460 AGTGGTAGTCAGTTGGTGGGAGG - Intergenic
1199606561 X:149583879-149583901 AGGTGTGGGCAGATGTTGGTTGG - Intronic
1199632562 X:149785489-149785511 AGGTGTGGGCAGATGTTGGTTGG + Intronic
1200684686 Y:6247699-6247721 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1200830883 Y:7688094-7688116 AGTGGAAGGAAGATGGTGGGTGG - Intergenic
1200836944 Y:7741106-7741128 AGTTGTAGGGAGATGGAAGGGGG - Intergenic
1200990216 Y:9338964-9338986 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1200992878 Y:9359279-9359301 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1200995531 Y:9379557-9379579 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1200998197 Y:9399903-9399925 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1201000706 Y:9468437-9468459 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1201003372 Y:9488767-9488789 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1201006028 Y:9509049-9509071 AGTGGAAGGAAGATGGTGGGTGG + Intergenic
1201008686 Y:9529362-9529384 AGTGGAAGGAAGATGGTGGGTGG + Intronic
1201294505 Y:12452162-12452184 ACTTGAAGGCAGAGGGTGGGAGG + Intergenic
1201946099 Y:19512117-19512139 AGTTGATGGCAGCTGTTGGCTGG - Intergenic
1202100326 Y:21300681-21300703 AGTTGAAGGCAGATTGTTTCTGG - Intergenic