ID: 1155137014

View in Genome Browser
Species Human (GRCh38)
Location 18:23005858-23005880
Sequence TTGCATCTGCATAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155137014_1155137018 7 Left 1155137014 18:23005858-23005880 CCCTCCTCATTATGCAGATGCAA 0: 1
1: 0
2: 0
3: 27
4: 260
Right 1155137018 18:23005888-23005910 AAAAAAGTAGTTGCAGAGGCAGG 0: 1
1: 1
2: 8
3: 61
4: 633
1155137014_1155137020 16 Left 1155137014 18:23005858-23005880 CCCTCCTCATTATGCAGATGCAA 0: 1
1: 0
2: 0
3: 27
4: 260
Right 1155137020 18:23005897-23005919 GTTGCAGAGGCAGGGTGCAGTGG 0: 1
1: 0
2: 23
3: 238
4: 1771
1155137014_1155137017 3 Left 1155137014 18:23005858-23005880 CCCTCCTCATTATGCAGATGCAA 0: 1
1: 0
2: 0
3: 27
4: 260
Right 1155137017 18:23005884-23005906 AAAGAAAAAAGTAGTTGCAGAGG 0: 1
1: 0
2: 5
3: 124
4: 1236
1155137014_1155137019 8 Left 1155137014 18:23005858-23005880 CCCTCCTCATTATGCAGATGCAA 0: 1
1: 0
2: 0
3: 27
4: 260
Right 1155137019 18:23005889-23005911 AAAAAGTAGTTGCAGAGGCAGGG 0: 1
1: 0
2: 7
3: 51
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155137014 Original CRISPR TTGCATCTGCATAATGAGGA GGG (reversed) Intronic
901300706 1:8198227-8198249 GTGCAGCTGTAAAATGAGGATGG + Intergenic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904688530 1:32276688-32276710 TTGCAGCTGCTTCATGAGGTTGG - Exonic
906419403 1:45651604-45651626 TTTCAGCTGCATATAGAGGATGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
906907799 1:49914372-49914394 TTGCAACTTTATAATGAGGATGG + Intronic
907009391 1:50949260-50949282 TTGCATCAGAATAATTTGGAGGG - Intronic
907383704 1:54111699-54111721 TTTCATTTGCCAAATGAGGATGG - Intronic
908056211 1:60289906-60289928 GTGCATCTGAATAATGGGAAAGG - Intergenic
908429747 1:64044361-64044383 TTGCTTTTGCACAATTAGGATGG - Intronic
909236886 1:73164226-73164248 TGGCATCTGCTGACTGAGGATGG + Intergenic
909468663 1:76002268-76002290 TTGCAACTGTGTAATAAGGATGG + Intergenic
910905288 1:92170922-92170944 TTGCAGATATATAATGAGGAAGG - Intronic
913420572 1:118663508-118663530 TTGCATCTTCATTGTGAGAATGG - Intergenic
914913791 1:151805942-151805964 TTGGATCTGTATAATGCTGATGG + Exonic
916287369 1:163123924-163123946 TAACATTTGTATAATGAGGAGGG + Intronic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917661325 1:177180189-177180211 TTGCATATGGAAACTGAGGAAGG + Intronic
919400428 1:197109252-197109274 TTGCATCTGTGTAATGAGTTGGG - Intronic
919753934 1:201054825-201054847 CTGCATCTCCAAAATGAGAAGGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
922113720 1:222589226-222589248 TTTCATATGGGTAATGAGGAAGG - Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1064069348 10:12212834-12212856 TTGCATATACATAATGGGGATGG - Intronic
1065457305 10:25920664-25920686 TTGCTTCTGCATAAAAAGGTAGG - Intergenic
1065963403 10:30752399-30752421 TTTCATCTGCAGAATGACCAAGG - Intergenic
1066216502 10:33293376-33293398 TTGCATCTTTATAATGGGGATGG + Intronic
1067211664 10:44264720-44264742 TTGCATTTTCAAAATGATGATGG + Intergenic
1069134055 10:64742138-64742160 TTGGATCTGGGTAATGAGTAGGG + Intergenic
1069135803 10:64763753-64763775 AGGCATCTGCATTATGGGGATGG - Intergenic
1069332434 10:67308609-67308631 TGGTATATGCATAATGAGTATGG + Intronic
1070393928 10:75995273-75995295 TTGCAGCTGCATTCTGAGGAAGG + Intronic
1071296481 10:84224252-84224274 TTGAATCTCTCTAATGAGGATGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071549600 10:86556524-86556546 TGACAGCTGAATAATGAGGAGGG + Intergenic
1072439203 10:95438940-95438962 TTCCATCTGTGTAATGAGGGTGG + Intronic
1073001208 10:100287383-100287405 TTGAAGGTGCAAAATGAGGAGGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073261191 10:102191738-102191760 TGGCTGCTTCATAATGAGGAGGG - Intergenic
1074184034 10:111085962-111085984 TTGCATCTGCATAGTCAGGGAGG - Intergenic
1074386543 10:113020862-113020884 TTGCATCTACAGAATGAGGGAGG + Intronic
1075672505 10:124272159-124272181 TTTCATCTGGATAAAGGGGAGGG + Intergenic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1079506009 11:21153043-21153065 TGCCATCTGCATAAACAGGAAGG - Intronic
1081407274 11:42712228-42712250 TCACCTCTGCATGATGAGGATGG - Intergenic
1082775564 11:57241905-57241927 TTGCTTGTGCATAGTGAGGTAGG + Intergenic
1082818541 11:57527547-57527569 TTGCAACTACCTAATGAGGTGGG + Intergenic
1084508675 11:69587692-69587714 TTGGGTCTGCAGAATGAGGCAGG - Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086325993 11:85700036-85700058 TTGTATCTGCACAATGTGAATGG - Intronic
1087496219 11:98893880-98893902 TTGCATCAGCATAACTTGGATGG - Intergenic
1087806738 11:102563539-102563561 GTGCACTTGCATCATGAGGATGG - Intergenic
1087917579 11:103829111-103829133 TTGCAACTGTATAATAAAGATGG - Intergenic
1088060644 11:105645101-105645123 ATGCAGCTTCATAATCAGGAAGG + Intronic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1091014741 11:132039768-132039790 TTACATCTGCAATATGAGCATGG - Intronic
1091138215 11:133212081-133212103 TTACACCTGCATAGTGAGGTGGG + Intronic
1093194559 12:16114660-16114682 TTGCATCAGAAGAATGAGGCAGG - Intergenic
1093688259 12:22081108-22081130 TTGCATCTGTAGAATTAGAAGGG - Intronic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1094119988 12:26961852-26961874 TTGCAGCTGCAAACTGAGTAAGG - Intronic
1094236921 12:28178452-28178474 TTGCTTCTGCAAAAATAGGATGG + Intronic
1095333418 12:40996968-40996990 TTCAATCAGCATAATGAGGCTGG - Intronic
1095349264 12:41189201-41189223 TTCCTGCTGCATAGTGAGGAAGG - Intronic
1095918610 12:47506260-47506282 TTGCATCTCCATTATTATGAAGG - Intergenic
1098945604 12:76586054-76586076 TTGCAGCTGCATCTGGAGGAGGG + Intergenic
1100863963 12:98835990-98836012 TTGCATCTCTAAAATGAGAATGG - Intronic
1101515978 12:105435519-105435541 TTGCAACTGCATAGCAAGGATGG + Intergenic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1103630754 12:122258614-122258636 TTGCATTTCCATAATGACTAAGG - Intronic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1105209799 13:18250846-18250868 TGGCCTCTGCCTGATGAGGATGG - Intergenic
1106974778 13:35196613-35196635 TTTCATGTACATAATGGGGAAGG + Intronic
1107216905 13:37932683-37932705 TTGCCTCTGCATGAAGAAGAAGG + Intergenic
1110479933 13:75962172-75962194 TAGCAGCTCCATAATGTGGAAGG + Intergenic
1111809628 13:93083068-93083090 TTGATTCTCCATAATGTGGATGG - Intergenic
1112123700 13:96441073-96441095 TTGAATCTGCATATGGTGGAGGG - Intronic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113010333 13:105757907-105757929 TGGGATCTGCATTAGGAGGAAGG - Intergenic
1115444468 14:33473333-33473355 TTGCATGTGAATCATGTGGAGGG - Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118149933 14:63178734-63178756 TTGTATCTCCATTATGATGAGGG - Intergenic
1119026347 14:71155895-71155917 TTTCTTCTGGACAATGAGGATGG + Intergenic
1120015091 14:79463749-79463771 TTGCATCAGCATACTGAACACGG + Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1120262529 14:82204778-82204800 TTTCAACTGCATGGTGAGGAAGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1125436893 15:39655715-39655737 GGGCATCTGAATAAGGAGGATGG - Intronic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1126718059 15:51543383-51543405 TTCCATATGCAAAATGAGAAGGG - Intronic
1127276143 15:57445949-57445971 TTACATTTCCATAATGAAGAGGG - Intronic
1130430854 15:83845550-83845572 TTTCATCTGCACAGTGAGCATGG + Intronic
1131445158 15:92492757-92492779 TTCCATCTGCAGGATGAGGCTGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1132772992 16:1574928-1574950 ATGCATCTGCATCCTGAGGAGGG + Intronic
1134201143 16:12200122-12200144 TTTCATCTGTACAATGAGGTTGG + Intronic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1135349961 16:21720559-21720581 TTGCATCAGCATTGTGTGGAAGG + Intronic
1139232602 16:65299154-65299176 TTGCATTTGTATAATGATCAGGG - Intergenic
1140726848 16:77821237-77821259 TGGGATCTGCATAATTATGAAGG + Intronic
1141289546 16:82704977-82704999 TTGCTGCTGCCTCATGAGGAAGG + Intronic
1143382647 17:6506179-6506201 AACCAGCTGCATAATGAGGAAGG + Intronic
1143914652 17:10280733-10280755 TTGCATTTTCCTAATGATGAGGG + Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145354346 17:22126118-22126140 TTGCATATGCATATTTAGGTTGG + Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147991471 17:44336287-44336309 TTGGATCTTTATAATGAAGAAGG + Intergenic
1149536423 17:57437082-57437104 TTCCATCTTCCTGATGAGGAGGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1155080098 18:22400777-22400799 TTGCATTTTCTTAATGACGAAGG - Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1158799266 18:60887317-60887339 GTGCATTTGCATACTGAGGAAGG + Intergenic
1159593685 18:70361945-70361967 TTGCATTTGATAAATGAGGAAGG + Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160055982 18:75481039-75481061 TTGCATTTCCCTAATGAGTAAGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160495897 18:79374961-79374983 TTGCATCTGCAAACTGGAGACGG + Intronic
1161953207 19:7478890-7478912 TGGCATCTGCAGGCTGAGGAAGG + Intronic
1164413315 19:28023299-28023321 TGGCACCTGCACAATGAGAATGG - Intergenic
1166023694 19:40057355-40057377 TTACATCATCATAATGATGAAGG + Intergenic
926263399 2:11290229-11290251 TTGAAACTGCATAACAAGGAAGG - Intronic
926767129 2:16331207-16331229 TTGCATCTGCATCCTGTGGCAGG - Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928323611 2:30302843-30302865 TTGCCTCAGCTTAGTGAGGAAGG - Intronic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
930264236 2:49181257-49181279 TTGCATCTCTCTAATGAGCAGGG + Intergenic
931496436 2:62812628-62812650 TTGCAACTTCATAATAAGGATGG - Intronic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
932845207 2:75128160-75128182 TTGCAACTGCTGAATGAAGATGG - Intronic
933737250 2:85504987-85505009 ATTCATCTGGGTAATGAGGAGGG + Intergenic
933737398 2:85506019-85506041 GTTCATCTGGCTAATGAGGAGGG + Intergenic
934854566 2:97720975-97720997 TTGCATTTGCATAACTAAGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
938285297 2:130109232-130109254 TGGCTTCTGCATAAGGAGGCAGG - Intronic
938628273 2:133135735-133135757 TTTCCTCTGCATACTGGGGACGG + Intronic
939891575 2:147743197-147743219 TTGCAACTGTATAACAAGGATGG - Intergenic
941153710 2:161948166-161948188 TTGCATCTGCATATTTGGAAAGG + Intronic
944853192 2:203741440-203741462 TTGCATCTGGTGACTGAGGAAGG + Intergenic
945044666 2:205771229-205771251 TTCCATCTGCCTTATGAGCATGG - Intronic
946009863 2:216555663-216555685 TTGCATCTGCAGCCTGGGGAGGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
949076639 2:242063361-242063383 TTGCTTCTGCCTAAAGAGGTGGG + Intergenic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1173439161 20:43060085-43060107 TTGGAACTGGATAATGAGGCTGG - Intronic
1173645074 20:44628219-44628241 TTGCATCTTCAGGATGAGGATGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174741164 20:53015519-53015541 TAGAATTTGCACAATGAGGATGG + Intronic
1178285498 21:31322321-31322343 TTGCATCTGCCTCATAATGATGG + Intronic
1181928883 22:26383256-26383278 AAGCATCTGCATAATCAGGAGGG + Intronic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1183442657 22:37831961-37831983 CTGCATCTGCAGACTGAGGGAGG + Exonic
1184318956 22:43724252-43724274 TTGCAACTGTATAAAAAGGATGG + Intronic
949831184 3:8216190-8216212 GTGCATGTGCATTTTGAGGATGG + Intergenic
950448082 3:13049569-13049591 TTGCGTCTGGATAAGGAGGCAGG - Intronic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
951366307 3:21787457-21787479 TAGCATCTGGATAAGGAGTAGGG - Intronic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
958459546 3:94377509-94377531 ATGCATCAGCATTATGTGGAGGG + Intergenic
959384327 3:105683151-105683173 TTGAATCTTCATAATAATGATGG + Intronic
959972988 3:112427899-112427921 TTGCAACTGTATAACAAGGAAGG - Intergenic
961505238 3:127366504-127366526 TTGCATCTCCCTAATGACTAAGG - Intergenic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
963331983 3:143924647-143924669 TTTCATCTCCATGATGAGAATGG - Intergenic
964091052 3:152876012-152876034 TTCCATCTGTAAAATGAGGGTGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965416435 3:168400422-168400444 TTGCATCTGCATATTGGCGGTGG + Intergenic
966606329 3:181825082-181825104 TTGCATCTGAATAAGGAACAAGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967654954 3:192036177-192036199 ATGCAAATGCATATTGAGGAAGG + Intergenic
968066918 3:195763956-195763978 TGGCATCTGGATAAGGAGTAGGG - Intronic
968075982 3:195816362-195816384 TGGCATCTGCGTAAGGAGAAGGG - Intergenic
968810898 4:2799288-2799310 CTGCAGCTGCCTAATGAGGTGGG + Intronic
972779928 4:42278556-42278578 TTGCATTTAAATAATGGGGAGGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
974211262 4:58779241-58779263 TTGAATCTACATACAGAGGAAGG - Intergenic
975112178 4:70640494-70640516 TTGCAACTGCATAAAGTGCAAGG + Intronic
975112337 4:70642059-70642081 TTTCTTCTGAATAATAAGGAGGG - Exonic
975800373 4:78055280-78055302 TAGCAGCTGCAAAATTAGGAGGG + Intergenic
975972317 4:80055215-80055237 TTGCCTATGGAGAATGAGGAGGG + Exonic
976442735 4:85094555-85094577 TAGCATCTTAATAATCAGGAAGG + Intergenic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
977211600 4:94224406-94224428 TTGCATATACATAATGAGATTGG + Intronic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
977733697 4:100384735-100384757 TTTCATCTGTATAATGATGTTGG - Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
979210527 4:118095708-118095730 GTGCAACTGATTAATGAGGATGG - Intronic
980423228 4:132592234-132592256 CTCCATCTCCATGATGAGGAGGG - Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
982821344 4:159943825-159943847 CTGCATCTGCCTCTTGAGGATGG - Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
986985820 5:13500139-13500161 GTGCAATTGTATAATGAGGATGG - Intergenic
987539510 5:19235952-19235974 TTACTTGTGCTTAATGAGGATGG - Intergenic
989678479 5:44002064-44002086 TTGCCATGGCATAATGAGGAGGG - Intergenic
989957418 5:50373422-50373444 TTGCCTCTGCATACTGGGCATGG - Intergenic
992588560 5:78269067-78269089 TTGAATCTACGTAATGAAGAAGG - Intronic
997778433 5:136632300-136632322 TTGCATCTCTTTAATGAGTAAGG + Intergenic
1000743611 5:165001709-165001731 TTGCATCTGGTAAATGAAGATGG - Intergenic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1001914077 5:175544924-175544946 TTGCATATGTAGAATGAGAATGG + Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1005020894 6:21417807-21417829 TTGGATTTGCATAATGTTGACGG - Intergenic
1007699691 6:43759351-43759373 ATGCATATGTATTATGAGGAAGG - Intergenic
1007790297 6:44304769-44304791 TTGCAACTGTATACAGAGGACGG - Exonic
1011507556 6:88063531-88063553 TTGCCTCTGGAGGATGAGGAAGG + Intronic
1013579347 6:111517704-111517726 TAGCATATGCATAATAAAGATGG + Intergenic
1013730052 6:113154702-113154724 TTGCAACTGTATAAAAAGGACGG - Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015557295 6:134476402-134476424 CTGCATCAGAATAATGAGGAAGG - Intergenic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1018641044 6:165904288-165904310 TTGCATCTGCCTTAGGAGAAGGG + Intronic
1021183187 7:17532564-17532586 TTGCCTCTGTTCAATGAGGACGG + Intergenic
1021211544 7:17860224-17860246 TTGCATTTCCATAATGATTAGGG + Intronic
1021222849 7:17993134-17993156 TTGCATATACATGATGAGGGAGG - Intergenic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1022169033 7:27805242-27805264 TTGCATCTCTATTATGAGCAAGG + Intronic
1024202903 7:47124721-47124743 TTGCCTCTGCATTTTGGGGAGGG + Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1027982636 7:85245575-85245597 TTTCATGTGTATACTGAGGATGG - Intergenic
1028156995 7:87441463-87441485 TCGCATGTTCATAATGAGCAGGG + Intronic
1029254772 7:99262138-99262160 TTGCATTTGCATAATTAATAGGG + Intergenic
1031516658 7:122709124-122709146 TTGGATCTTAATAATGAGAAGGG - Intronic
1031536182 7:122936117-122936139 TTGAAGCTACATAATGTGGAAGG - Intergenic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1033420703 7:141202401-141202423 TTCCATGTGTGTAATGAGGAGGG + Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034640847 7:152601282-152601304 TTGCATCTGCCCAAAGAGGGTGG - Intergenic
1036445551 8:8819230-8819252 TTGCATGTATATAATGAGTAGGG - Intronic
1036508671 8:9380275-9380297 ATGAGTCTGCATAATGAGCAAGG + Intergenic
1038093397 8:24280321-24280343 ATGCATCTGCATAACTAAGAAGG - Intergenic
1041129073 8:54677289-54677311 ATGCATCTGCATCACCAGGAGGG - Intergenic
1041528102 8:58831462-58831484 TTGCATTGGCATAATGAATATGG + Intronic
1041580313 8:59451023-59451045 TTGCTTCAGCATCATAAGGATGG - Intergenic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1042472975 8:69212329-69212351 TTTCATCTGCATGAGAAGGATGG + Intergenic
1043395141 8:79828221-79828243 TTGCATCTTCATACTGAACAAGG + Intergenic
1047012373 8:120685946-120685968 TTGCCACTTTATAATGAGGATGG + Intronic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1051563702 9:18472034-18472056 TTGGATCTGCTTAATGAGCAGGG + Intergenic
1052480122 9:29013325-29013347 TTGCATCTGAAAAGTGAGTAAGG - Intergenic
1056134600 9:83619651-83619673 TTGAATCTGTATAATTTGGAGGG + Intergenic
1056553641 9:87671886-87671908 TTGCTTCTACATAAAGATGAGGG - Intronic
1056942306 9:90966035-90966057 TTGCATATGGAAAATCAGGAAGG + Intergenic
1057477606 9:95416196-95416218 TTGCCACTGTATAATAAGGATGG + Intergenic
1057825627 9:98370303-98370325 TTTCACCTGCATCAAGAGGACGG + Intronic
1059368692 9:113807619-113807641 TTCTATCCGCCTAATGAGGAAGG - Intergenic
1059459286 9:114419753-114419775 TAGGATCTGTAAAATGAGGATGG - Intronic
1059656263 9:116360358-116360380 TTGCAGCTGCATGCTCAGGATGG + Intronic
1059909390 9:119025584-119025606 TTGCTTGTGCATAATTAAGATGG - Intergenic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187555476 X:20347058-20347080 TTGTCTCTGCATCTTGAGGATGG + Intergenic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1191717405 X:64203265-64203287 TTGAGTGTGCCTAATGAGGATGG - Intronic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1193650261 X:84122935-84122957 TTCCTTCTGCTTAAGGAGGAAGG + Intronic
1193751226 X:85346831-85346853 TTTCATCTGCAAAATTAGTAGGG - Intronic
1194969585 X:100328373-100328395 TTACATTTGCATGATGAAGATGG - Intronic
1196099747 X:111835453-111835475 TTGCCTCTGCATAATTAGAATGG - Intronic
1198039288 X:132833992-132834014 CTGTATCTGCCAAATGAGGATGG - Intronic
1198719818 X:139604375-139604397 TTACATCTTCATAGTCAGGATGG + Intronic
1199043277 X:143139486-143139508 TTGCATCAGCATAACCTGGATGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199949267 X:152693502-152693524 TTTAATCTCCATAATGTGGATGG - Intergenic
1199960409 X:152774947-152774969 TTTAATCTCCATAATGTGGATGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201553789 Y:15247307-15247329 TTGTTTCTGCATCATCAGGATGG - Intergenic
1201940029 Y:19449351-19449373 TAGCTTCTGCTCAATGAGGAAGG - Intergenic