ID: 1155141705

View in Genome Browser
Species Human (GRCh38)
Location 18:23050134-23050156
Sequence GCCCATCTGGCCAATCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155141696_1155141705 26 Left 1155141696 18:23050085-23050107 CCCAGATGTGAGGTCAGCAATCC No data
Right 1155141705 18:23050134-23050156 GCCCATCTGGCCAATCCTGGAGG No data
1155141697_1155141705 25 Left 1155141697 18:23050086-23050108 CCAGATGTGAGGTCAGCAATCCC No data
Right 1155141705 18:23050134-23050156 GCCCATCTGGCCAATCCTGGAGG No data
1155141701_1155141705 -3 Left 1155141701 18:23050114-23050136 CCTGTGCACTCCATGTCTCTGCC No data
Right 1155141705 18:23050134-23050156 GCCCATCTGGCCAATCCTGGAGG No data
1155141695_1155141705 29 Left 1155141695 18:23050082-23050104 CCTCCCAGATGTGAGGTCAGCAA No data
Right 1155141705 18:23050134-23050156 GCCCATCTGGCCAATCCTGGAGG No data
1155141699_1155141705 5 Left 1155141699 18:23050106-23050128 CCCACTGGCCTGTGCACTCCATG No data
Right 1155141705 18:23050134-23050156 GCCCATCTGGCCAATCCTGGAGG No data
1155141700_1155141705 4 Left 1155141700 18:23050107-23050129 CCACTGGCCTGTGCACTCCATGT No data
Right 1155141705 18:23050134-23050156 GCCCATCTGGCCAATCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155141705 Original CRISPR GCCCATCTGGCCAATCCTGG AGG Intergenic
No off target data available for this crispr