ID: 1155142313

View in Genome Browser
Species Human (GRCh38)
Location 18:23054453-23054475
Sequence TCTCCTTCTTGCACCTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155142313_1155142315 18 Left 1155142313 18:23054453-23054475 CCAGTGAAGGTGCAAGAAGGAGA No data
Right 1155142315 18:23054494-23054516 TAGCGACACAACTCAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155142313 Original CRISPR TCTCCTTCTTGCACCTTCAC TGG (reversed) Intergenic
No off target data available for this crispr