ID: 1155149759

View in Genome Browser
Species Human (GRCh38)
Location 18:23113693-23113715
Sequence GAACCAGGGATGGCTGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155149759_1155149767 -8 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149767 18:23113708-23113730 CCTGGTTCTGGGACGTCCATGGG No data
1155149759_1155149771 4 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149771 18:23113720-23113742 ACGTCCATGGGCATGGCCTGGGG No data
1155149759_1155149768 -3 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149768 18:23113713-23113735 TTCTGGGACGTCCATGGGCATGG No data
1155149759_1155149775 28 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149775 18:23113744-23113766 CTCACTTGAGCAAAATTCCATGG No data
1155149759_1155149772 5 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149772 18:23113721-23113743 CGTCCATGGGCATGGCCTGGGGG No data
1155149759_1155149770 3 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149770 18:23113719-23113741 GACGTCCATGGGCATGGCCTGGG No data
1155149759_1155149765 -9 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149765 18:23113707-23113729 CCCTGGTTCTGGGACGTCCATGG No data
1155149759_1155149769 2 Left 1155149759 18:23113693-23113715 CCAGAACCAGCCATCCCTGGTTC No data
Right 1155149769 18:23113718-23113740 GGACGTCCATGGGCATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155149759 Original CRISPR GAACCAGGGATGGCTGGTTC TGG (reversed) Intergenic
No off target data available for this crispr