ID: 1155152774

View in Genome Browser
Species Human (GRCh38)
Location 18:23135788-23135810
Sequence GCCGCTGCTGCAGGCGGCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155152774_1155152779 0 Left 1155152774 18:23135788-23135810 CCACGGCCGCCTGCAGCAGCGGC 0: 1
1: 0
2: 2
3: 51
4: 382
Right 1155152779 18:23135811-23135833 AGCGCCGGCACCGACGCCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1155152774_1155152781 9 Left 1155152774 18:23135788-23135810 CCACGGCCGCCTGCAGCAGCGGC 0: 1
1: 0
2: 2
3: 51
4: 382
Right 1155152781 18:23135820-23135842 ACCGACGCCGCGGGCGCCAGCGG 0: 1
1: 0
2: 2
3: 2
4: 55
1155152774_1155152778 -1 Left 1155152774 18:23135788-23135810 CCACGGCCGCCTGCAGCAGCGGC 0: 1
1: 0
2: 2
3: 51
4: 382
Right 1155152778 18:23135810-23135832 CAGCGCCGGCACCGACGCCGCGG 0: 1
1: 0
2: 0
3: 17
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155152774 Original CRISPR GCCGCTGCTGCAGGCGGCCG TGG (reversed) Exonic