ID: 1155153640

View in Genome Browser
Species Human (GRCh38)
Location 18:23141097-23141119
Sequence AGAGTGGCCACCCTTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155153635_1155153640 -6 Left 1155153635 18:23141080-23141102 CCAGTTCCCTGGAATGCAGAGTG 0: 1
1: 1
2: 2
3: 39
4: 206
Right 1155153640 18:23141097-23141119 AGAGTGGCCACCCTTTGAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155153640 Original CRISPR AGAGTGGCCACCCTTTGAGG AGG Intronic
901780352 1:11590193-11590215 GGAGTGGCCACCATGTCAGGGGG - Intergenic
903339081 1:22643048-22643070 CCAGTGGCCACACTTGGAGGTGG - Intergenic
907101294 1:51839127-51839149 AAAGTGGTCACCCTTAAAGGTGG - Intronic
907851664 1:58260574-58260596 AGAGTGGCCAGACTTGGAGTTGG - Intronic
909051617 1:70774470-70774492 AGAGGGCCCACCCAGTGAGGAGG + Intergenic
912815829 1:112827302-112827324 AGACTGGCCAGCATTAGAGGTGG + Intergenic
916766373 1:167864373-167864395 AGACTGGCCAACATTAGAGGTGG + Intronic
917115774 1:171601619-171601641 AGACTGGCCAGCATTAGAGGTGG + Intergenic
917496663 1:175546608-175546630 AGAGTGGCGTGCCTTTCAGGAGG + Intronic
917902721 1:179559155-179559177 AGACTGACCTCCCTTTGAGGAGG - Intronic
918647751 1:186921982-186922004 AGACTGGCCAGCATTAGAGGTGG - Intronic
920175783 1:204100949-204100971 AGCTTGGCCAGCCCTTGAGGAGG - Intronic
920450100 1:206053675-206053697 AGACTGGCCAGCATTAGAGGTGG + Intronic
922047254 1:221958161-221958183 AGAATGTCAACCCTTTGAGCCGG + Intergenic
922680960 1:227595457-227595479 AGACTGGCCAGCATTAGAGGTGG - Intronic
922689958 1:227680441-227680463 AGACTGGCCAGCATTAGAGGTGG + Intergenic
922803504 1:228374467-228374489 TGAGTGGCCATCCTGTGAGCTGG + Intronic
922814440 1:228438843-228438865 AGAGTTGGCATCCTTTGGGGAGG - Intergenic
1068809534 10:61240380-61240402 AGAGTTTCCACTATTTGAGGTGG - Intergenic
1069868123 10:71516654-71516676 AGAGTGGCTACCCCAGGAGGTGG - Intronic
1070805957 10:79270872-79270894 ATAGTGGCCATCTTTTGTGGGGG - Intronic
1072224027 10:93351249-93351271 AGATTTGGCGCCCTTTGAGGGGG + Exonic
1072689242 10:97560643-97560665 AGACTGGCCAGCATTAGAGGTGG - Intronic
1074120885 10:110493902-110493924 AGAGTGGCCAGCTTTTTAGGAGG - Intergenic
1074143707 10:110698480-110698502 AGTGTTGACACCCTGTGAGGAGG + Intronic
1074755748 10:116622649-116622671 AGAGGGTGCACCCTTGGAGGTGG - Intronic
1079995414 11:27290493-27290515 AGGGTGGCCACCCACAGAGGAGG - Intergenic
1081290511 11:41319653-41319675 AGACTAGCCACCCTGGGAGGTGG - Intronic
1083197093 11:61094832-61094854 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1083328806 11:61887334-61887356 TGAGTGGCCTCCCTTGGGGGAGG + Intronic
1083640302 11:64141789-64141811 AGGGTGGCCACCCCATGTGGGGG + Intronic
1085239553 11:75041166-75041188 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1086973677 11:93109727-93109749 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1087037823 11:93772500-93772522 AGAGCGGCAGCCCTTTGGGGAGG - Intronic
1087684290 11:101245674-101245696 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1087894569 11:103573161-103573183 AGACTGGCCAGCATTTGAGGTGG + Intergenic
1088393339 11:109340388-109340410 AGAGTCTCCAAACTTTGAGGGGG + Intergenic
1090256344 11:125287309-125287331 AAAGTAGCAACCCTTTGGGGAGG + Intronic
1091356386 11:134941024-134941046 AAAGAGGCCACCCTGTGGGGGGG + Intergenic
1091987871 12:4927633-4927655 AGAGAGCCAAACCTTTGAGGTGG - Intronic
1092012750 12:5128675-5128697 AAAGTAGCCCCCATTTGAGGAGG - Intergenic
1096207519 12:49735361-49735383 AGACTGGCCAGCATTAGAGGTGG + Intronic
1098201823 12:68064207-68064229 AGAGTCCCCACCCAGTGAGGAGG + Intergenic
1098639595 12:72823491-72823513 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1101029809 12:100647496-100647518 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1102027210 12:109720333-109720355 AGGGGGGCCTCCCTTGGAGGAGG + Intronic
1103280680 12:119755795-119755817 AGAGTGGCCAGGTTTTGGGGAGG - Intronic
1105919009 13:24943257-24943279 TGAGTGGCAACCCTTTACGGTGG - Intergenic
1107491074 13:40880218-40880240 AGACTGGCCAGTATTTGAGGTGG - Intergenic
1109802450 13:67398305-67398327 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1113108679 13:106798794-106798816 AGAGTGGCTGCCCTTAGGGGTGG + Intergenic
1113741633 13:112715623-112715645 AGAGGGGCAACCCTCTGGGGAGG - Intronic
1114797257 14:25730134-25730156 ATAGTGGCTACCATTGGAGGGGG - Intergenic
1115343648 14:32318893-32318915 AGAGTGGCCCCTCTTTGGGTGGG + Intergenic
1118904460 14:70013569-70013591 AGAGTGGGCAGGGTTTGAGGAGG + Intronic
1122408505 14:101514173-101514195 AGAGAGGCCTCCATCTGAGGAGG - Intergenic
1123084988 14:105713203-105713225 TGAGTGGACTCCCGTTGAGGGGG + Intergenic
1126416032 15:48418187-48418209 AAAGTGGGCACCCTTCAAGGTGG + Intronic
1129986143 15:79921477-79921499 AGAGGGGCCAAACTTTGAGGAGG - Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1132810198 16:1793590-1793612 AGACTGGCCACCCCTAGAGTGGG + Intronic
1133271061 16:4610976-4610998 AGACTTGCTACCCGTTGAGGTGG - Intronic
1134814973 16:17198320-17198342 AGAATGGCCACCATCTGGGGAGG - Exonic
1138044839 16:53710814-53710836 ATAGTGGCTTCCCTTTTAGGTGG + Intronic
1138239606 16:55416707-55416729 AGAGTGTAGACCCTTTGTGGGGG + Intronic
1141962072 16:87415638-87415660 AGAGCCGCCAGCCTGTGAGGTGG - Intronic
1142070910 16:88090917-88090939 CGGGTGTCCACCCTCTGAGGTGG - Intronic
1143539318 17:7559882-7559904 ATAGTGCTCACCCTTGGAGGTGG - Exonic
1146763918 17:35501741-35501763 AGACTGGCCAGCATTAGAGGTGG + Intronic
1147327389 17:39676023-39676045 AGAGTGGCCATCCTCAAAGGAGG - Intronic
1149325693 17:55527717-55527739 AGAGAGGGCACCCTCTGAGCAGG + Intergenic
1150317003 17:64177444-64177466 AGAGGTTCCACCCTCTGAGGAGG - Exonic
1152058447 17:78050720-78050742 AGAGTGGCCATGCTTGGAGTGGG + Exonic
1155153640 18:23141097-23141119 AGAGTGGCCACCCTTTGAGGAGG + Intronic
1157290468 18:46406249-46406271 ACAGTGGCCACTCTCTGGGGAGG - Intronic
1158291684 18:55951521-55951543 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1158932382 18:62334406-62334428 AGAGATGCGACCCTCTGAGGCGG - Intronic
1162633465 19:11946652-11946674 AGACTGGCCAGCATTAGAGGTGG - Intronic
1162657342 19:12140831-12140853 AGAGTTTCCACACTGTGAGGTGG - Intronic
1162795557 19:13085676-13085698 AGAGTTGTCACCCTTGGAGTGGG + Intronic
1163647104 19:18495711-18495733 AGAGTGGCCACTCGTACAGGGGG - Intronic
1163867329 19:19785105-19785127 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1163934579 19:20431306-20431328 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1164130954 19:22361429-22361451 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1164699295 19:30271749-30271771 AGAGTAACCACCTTGTGAGGTGG + Intronic
1165037504 19:33044385-33044407 AGAGTGGCCGACCTCTGAAGGGG - Intronic
1165809355 19:38601430-38601452 AGAATGCCCACCCTTGGTGGAGG + Exonic
1168613093 19:57816394-57816416 AGACTGGCCAGCATTAGAGGTGG + Intronic
927184273 2:20470878-20470900 AGAGTGGCCAGGCTTTGGGAAGG + Intergenic
927465368 2:23332507-23332529 GGAGTGACCACCCTGAGAGGAGG - Intergenic
929472842 2:42213267-42213289 AGAGTGGTCATCCTTAGATGTGG - Intronic
932481108 2:72039913-72039935 AGAGTCTCCACCCATTGAGAAGG - Intergenic
943407866 2:187511608-187511630 AGACTGGCCAGCATTAGAGGTGG + Intronic
948579767 2:238978249-238978271 ACAGTGGCCACCCTTAGGGGTGG - Intergenic
1172513429 20:35515991-35516013 AGAGTGTCCACCCTGTGACCAGG - Exonic
1173759528 20:45547363-45547385 AGAGAGGCCAGCCTTTCTGGTGG + Exonic
1176688778 21:9880028-9880050 GGAGTGGTCAACCTTTGATGGGG + Intergenic
949206451 3:1444767-1444789 AGAGTACCCATCCTTTAAGGAGG + Intergenic
951621675 3:24608737-24608759 AGAGATGCCACCCTTTGAGATGG + Intergenic
954634705 3:52065210-52065232 AGACAGTCCAACCTTTGAGGCGG + Intergenic
957405739 3:79774014-79774036 AGACTGGCCAGCATTAGAGGTGG + Intergenic
958000169 3:87740199-87740221 AGACTGGCCAGCATTAGAGGTGG - Intergenic
961016049 3:123469242-123469264 ACAGTGGCCCCCCTTGTAGGTGG + Intergenic
961640909 3:128364345-128364367 AAAGTGGCCATCCTGAGAGGAGG + Intronic
962096933 3:132302286-132302308 AGACTGGCCAGCATTAGAGGTGG - Intergenic
962097133 3:132303719-132303741 AGACTGGCCAGCATTAGAGGTGG + Intergenic
962813021 3:138975048-138975070 AAGGTGGCCACAGTTTGAGGAGG + Intergenic
964522958 3:157586857-157586879 AGACTGGCCAACATTAGAGGTGG - Intronic
968509299 4:988319-988341 CAGGTGGCCACCCTGTGAGGGGG + Exonic
968967612 4:3777034-3777056 AAAGTACCCACCCTTTCAGGCGG - Intergenic
970993628 4:22239913-22239935 AGAGTGGTCACCTTTTGGCGGGG - Intergenic
972991558 4:44827495-44827517 AGACTGGCCAGCATTAGAGGTGG - Intergenic
977043812 4:92045065-92045087 AGACTGGCCAGCATTAGAGGTGG - Intergenic
980352163 4:131697842-131697864 GGAGTGGTCAACCTTTGATGGGG + Intergenic
982945144 4:161613039-161613061 ATATTAGCCACCCTCTGAGGTGG - Intronic
985510556 5:310955-310977 AGTGTGGCCGCCCTGTGGGGTGG + Intronic
989557527 5:42814561-42814583 AGACTGGCCAGCATTAGAGGTGG + Intronic
989775992 5:45207379-45207401 AGACTGGCCAGCATTAGAGGTGG + Intergenic
991305821 5:65174960-65174982 AGACTGGCCAGCATTAGAGGTGG + Intronic
994028099 5:95108281-95108303 AGAGTGGCTAGCCCATGAGGAGG + Intronic
995473291 5:112525015-112525037 AGACTGGCCAGCATTAGAGGTGG + Intergenic
997346008 5:133192696-133192718 AGACTGGCCTCCCCTTAAGGAGG + Intergenic
1000604969 5:163318234-163318256 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1000861571 5:166462109-166462131 AGAGTGCCAACCCTTTGGTGAGG - Intergenic
1002999348 6:2316959-2316981 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1003937350 6:10989212-10989234 ACTGTGGTTACCCTTTGAGGAGG + Intronic
1006032238 6:31185611-31185633 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1006570545 6:34999616-34999638 AGACTGGCCAGCATTAGAGGTGG + Intronic
1009449366 6:63783672-63783694 AGAGTGGGCTCTCATTGAGGAGG + Intronic
1020044086 7:5027456-5027478 AGACTGGCCAGCATTAGAGGTGG - Intronic
1021862763 7:24923361-24923383 ACAGTGGCTACCCTTTGTTGGGG - Intronic
1022489900 7:30808657-30808679 AGACTGGCCAGCATTAGAGGTGG + Intronic
1026075147 7:67159624-67159646 ATAGTGGCTACCTTTGGAGGTGG - Intronic
1026701703 7:72652546-72652568 ATAGTGGCTACCTTTGGAGGTGG + Intronic
1030909572 7:115229894-115229916 AGAGGTGCAACCCTTTGATGTGG + Intergenic
1032651436 7:133883057-133883079 ATAGTGGCTACCCTTAGAGAGGG - Intronic
1032979667 7:137267531-137267553 AGACTGGCCAGCATTTGAGGTGG - Intronic
1038089424 8:24236610-24236632 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1038672670 8:29595136-29595158 GAAGGGGGCACCCTTTGAGGTGG - Intergenic
1039877075 8:41596066-41596088 AGACTGGCCAACATTAGAGGTGG - Intronic
1041090522 8:54297265-54297287 AGAGTGGAAACCCTTTGGGAGGG + Intergenic
1044887027 8:96790428-96790450 AGAGTTTCCACCCTATGAGTAGG + Intronic
1049222267 8:141433527-141433549 TGAGTGGCCACCCTGGGCGGAGG + Intergenic
1053780547 9:41601872-41601894 GGAGTGGTCAACCTTTGATGGGG - Intergenic
1054168490 9:61812029-61812051 GGAGTGGTCAACCTTTGATGGGG - Intergenic
1054669039 9:67768789-67768811 GGAGTGGTCAACCTTTGATGGGG + Intergenic
1054744569 9:68841760-68841782 ATAGTGACCATCATTTGAGGTGG + Intronic
1055600285 9:77909462-77909484 ATATTGGCCTCCCTGTGAGGTGG - Intronic
1056053574 9:82796723-82796745 AGAGTGGTTACCCTTTGAGGAGG + Intergenic
1057975007 9:99596088-99596110 AGAGAGGCCACCCTATGATAAGG - Intergenic
1186517565 X:10177502-10177524 ATAGTGGTTACCCTTTGGGGTGG + Intronic
1186558792 X:10588882-10588904 AGACTGGCCAGCATTAGAGGTGG - Intronic
1186640124 X:11446682-11446704 AAGGTTGCCACCCTCTGAGGTGG - Intronic
1189167769 X:38878207-38878229 ATAGTGGCCACCCTTCGTGGGGG - Intergenic
1189234453 X:39476779-39476801 TCTGTGGCCACCCTTTGTGGAGG + Intergenic
1190063986 X:47227881-47227903 ACAGTGGCCACCCTTTGGGAAGG - Intronic
1190269969 X:48854843-48854865 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1190426396 X:50337568-50337590 AGACTGGCCAGCATTAGAGGTGG - Intronic
1190770971 X:53513794-53513816 AGACTGGCCAGCATTAGAGGTGG + Intergenic
1191918210 X:66225148-66225170 AGACTGGCCAGCATTAGAGGTGG - Intronic
1192309921 X:70002492-70002514 AGAGGGGCCATCCTATGAAGAGG + Intronic
1192596265 X:72411416-72411438 AGAGTTGACACCCTCAGAGGGGG + Intronic
1192630212 X:72771674-72771696 AGAGTGGTCACCTTTGGAGTGGG - Intergenic
1192651498 X:72949130-72949152 AGAGTGGTCACCTTTGGAGTGGG + Intergenic
1195116848 X:101707700-101707722 AGAGTGAGGACCCCTTGAGGAGG + Intergenic
1196460332 X:115923089-115923111 AGACTGGCCAGCATTAGAGGTGG - Intergenic
1197294175 X:124697236-124697258 AGACTGGCAACGCTTTGATGAGG + Intronic
1200984093 Y:9287954-9287976 AGACTGGCCAGCGTTTGAAGTGG - Intergenic
1201372815 Y:13283551-13283573 AGACTGGCCAGCATTAGAGGTGG + Intronic