ID: 1155157746

View in Genome Browser
Species Human (GRCh38)
Location 18:23171677-23171699
Sequence GAGGGTTATCAGAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 478}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155157746_1155157754 16 Left 1155157746 18:23171677-23171699 CCTGCCACCCTCTGATAACCCTC 0: 1
1: 0
2: 6
3: 37
4: 478
Right 1155157754 18:23171716-23171738 CAGAGTCCACAGCTGCTCATAGG 0: 1
1: 0
2: 0
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155157746 Original CRISPR GAGGGTTATCAGAGGGTGGC AGG (reversed) Intronic
900681942 1:3921275-3921297 GTGGGTCAGCAGAGGCTGGCTGG + Intergenic
900801239 1:4738423-4738445 GAGGGTGATTAGGGGGTAGCTGG + Intronic
900828346 1:4945036-4945058 GAGAGTTCTCAGAGGCTGCCAGG - Intergenic
902532464 1:17099159-17099181 GAGGGTCGCCAGAGAGTGGCAGG + Intronic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903221463 1:21871993-21872015 GAGGTTTATCAAATGGTGTCTGG + Intronic
903879714 1:26500582-26500604 GAGAGTTCTTCGAGGGTGGCGGG - Intergenic
904279659 1:29409841-29409863 GGTGGTCACCAGAGGGTGGCCGG + Intergenic
904956832 1:34291639-34291661 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
906151114 1:43588276-43588298 GAGGGTCCTCAGAGCATGGCTGG - Intronic
906826733 1:48989532-48989554 GATGGTTACCAGAGGCTGGAAGG - Intronic
906870873 1:49479458-49479480 GGGGCCTATCAGAGGGTGGAGGG - Intronic
910498676 1:87863523-87863545 GAGGGTTTTAAGAGGGTTGGGGG - Intergenic
910733370 1:90423255-90423277 GGGGTCTATCAGAGGGTGGATGG + Intergenic
911005101 1:93212494-93212516 GGGGTCTATCAGAGGGTGGAGGG - Intronic
912177014 1:107171724-107171746 GCAGGTTTTCAGAGGGTGGATGG - Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
913474278 1:119221863-119221885 GTGGATTATTAGAGGGTGTCAGG - Intergenic
914216264 1:145632411-145632433 GATGGTTACCAGAGGCTGGATGG - Intronic
914436310 1:147663276-147663298 GATGGTTATCAGAGGTGGGGGGG + Intronic
914468835 1:147955070-147955092 GATGGTTACCAGAGGCTGGATGG - Intronic
915382959 1:155459872-155459894 AGGGTTTATCAGAGGTTGGCTGG + Exonic
915674958 1:157520948-157520970 GAGGGTTATCAGAGGGTCCGCGG + Intronic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916394294 1:164368628-164368650 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
917528703 1:175813298-175813320 GGAGTTTATCAGAGGGTGGAGGG + Intergenic
919500762 1:198335710-198335732 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
919506589 1:198406449-198406471 GAAGATTCTCAGAGGGTGGAGGG + Intergenic
919576700 1:199319046-199319068 GAGGCTTTTCGGAGGGTGGAAGG - Intergenic
919578619 1:199342738-199342760 GGGGGCTATCAGAGGGTGAGAGG + Intergenic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
920900173 1:210102254-210102276 GGGGCCTATCAGAGGGTGGCAGG - Intronic
921242587 1:213200958-213200980 GGGGCCTGTCAGAGGGTGGCGGG + Intronic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
922254319 1:223879257-223879279 GAGAGAAATCAGATGGTGGCTGG - Intergenic
923017229 1:230136335-230136357 CAGGGTTATCAGAGGATGGCTGG - Intronic
924037022 1:239948280-239948302 GAGGCCTATCAGAGGGTGGCAGG + Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
924630993 1:245740703-245740725 GGGACTTATCAGAGGGTGGTGGG + Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063243319 10:4193306-4193328 GAGGGTTATGAAGTGGTGGCAGG + Intergenic
1063465187 10:6238721-6238743 GGGGCCTATCAGAGGGTGGTGGG - Intergenic
1063561813 10:7135202-7135224 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1063745265 10:8872179-8872201 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1064171560 10:13038195-13038217 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1064418329 10:15168953-15168975 GAGGGGTCTCAGAGGCGGGCGGG - Intergenic
1064649986 10:17499366-17499388 GGGGCCTTTCAGAGGGTGGCAGG + Intergenic
1064800137 10:19061107-19061129 GGGGCCTGTCAGAGGGTGGCGGG + Intronic
1064802932 10:19096614-19096636 GTGAGTTATTAGATGGTGGCAGG - Intronic
1066288191 10:33988974-33988996 GGGGCTTGTCAGAGGGTGGGGGG - Intergenic
1067265254 10:44736288-44736310 GATGGTTACCAGAGGCTGGGAGG - Intergenic
1068631156 10:59298938-59298960 TAGGGTTACCAGAGGCTGGTGGG + Intronic
1068631649 10:59304587-59304609 GGGGCCTTTCAGAGGGTGGCAGG + Intronic
1069444383 10:68459577-68459599 GGGGGTTGTCAGAGGCTGGGAGG + Intronic
1071010517 10:80934951-80934973 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1071234982 10:83634723-83634745 GAGGTTTATTGGAGGGTGGGAGG - Intergenic
1071408808 10:85366155-85366177 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1072375216 10:94808591-94808613 GATGGTTACCAGAGGCTGGGAGG - Intronic
1072871117 10:99121280-99121302 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1073539025 10:104303107-104303129 GAGGCCTATCAGAGGGTGCAGGG - Intronic
1075528975 10:123210981-123211003 GGGGCCTATCAGAGGGTGGGGGG - Intergenic
1077776204 11:5274532-5274554 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1078064035 11:8066286-8066308 GAGCGTTACCAGAGGCAGGCAGG + Intronic
1078175859 11:8969853-8969875 GATGGTTATCAGAGAGTAGGGGG - Intergenic
1078786330 11:14498021-14498043 GATGGTTATCAGAGGTGGGAAGG + Intronic
1078972468 11:16429665-16429687 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1079778228 11:24561661-24561683 GGGGCCTATCGGAGGGTGGCGGG + Intronic
1079806236 11:24933808-24933830 GAGAGTCATCAAAGGGTGGTGGG + Intronic
1081160397 11:39741914-39741936 GATGGTTATCAGAGGCTGGAAGG + Intergenic
1081211940 11:40346538-40346560 GAGGCCTATCAGAGGCTGGAAGG + Intronic
1083086109 11:60147519-60147541 GAGGGCTTTCAGAGGTTGGAGGG + Intergenic
1083089019 11:60180648-60180670 GAGGCCTTTCAGAGGGTGGAGGG - Intronic
1083614647 11:64020377-64020399 GAGGGTTTTCATAGGGCAGCTGG - Intronic
1084364331 11:68687778-68687800 GAGGGTTTGCACAGGGTGGGTGG - Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085317771 11:75555676-75555698 GGGGCTTGTCCGAGGGTGGCTGG - Intergenic
1085471728 11:76762898-76762920 GAGTGTTAGCAGGGGGTGGATGG - Intergenic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1086855689 11:91862455-91862477 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1087184134 11:95168772-95168794 GTGACTTATCAGCGGGTGGCTGG + Exonic
1087332629 11:96800163-96800185 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1087553793 11:99688759-99688781 GGGGCCTGTCAGAGGGTGGCGGG - Intronic
1087955571 11:104282804-104282826 AATGGTTACCAGAGGATGGCAGG - Intergenic
1088534284 11:110843080-110843102 GAGGCCTATCAGAAGGTGGAGGG - Intergenic
1089287988 11:117419977-117419999 GAGGGGTGTCAGAGCCTGGCAGG + Intergenic
1089294298 11:117458698-117458720 GGGGGTTAGCAGTGGGTGGCAGG + Intronic
1090067882 11:123519046-123519068 GAGGGCTAGCAAAGGGTGGCAGG - Intergenic
1091726195 12:2848315-2848337 GAGGGTGATGGGAAGGTGGCTGG - Intronic
1092173273 12:6386186-6386208 GAGGCTTCTCAGAGGGTGGAAGG - Intronic
1094299302 12:28943819-28943841 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1094406318 12:30119989-30120011 GATGGTTACCAGAGCCTGGCAGG - Intergenic
1094448193 12:30555771-30555793 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1095124626 12:38462190-38462212 GATGGTTACCAGAGGCTGGGAGG - Intergenic
1097194484 12:57236075-57236097 TAGGGTTAACCTAGGGTGGCAGG - Intronic
1097224890 12:57471338-57471360 GAAGATAATCAGGGGGTGGCTGG - Exonic
1097431300 12:59511047-59511069 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1097466741 12:59935468-59935490 GATGCTTATCAGAGGTTGGAAGG + Intergenic
1099036229 12:77590500-77590522 TGGGGTTATCAGAGGGTGGAGGG + Intergenic
1099524496 12:83702963-83702985 GATGGTTACCAGAGGTTGGGAGG + Intergenic
1099832258 12:87858650-87858672 GGTGGTTACCAGAGGGTGGGAGG + Intergenic
1099859994 12:88214595-88214617 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1101176930 12:102161809-102161831 CAGAGTTATCACAGGATGGCAGG + Intronic
1102971292 12:117169309-117169331 GGGGCCTATCAGAGGGTGGGCGG + Intronic
1104065648 12:125303157-125303179 TGAGGTTATCAGAGGCTGGCAGG - Intronic
1104138702 12:125965281-125965303 GGGGGCTATCAGGGGGTGGGGGG + Intergenic
1104255687 12:127135452-127135474 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1105913690 13:24893912-24893934 GAGGGTGATGGGAGAGTGGCTGG + Intronic
1106867038 13:33976393-33976415 GGGGGTTATCAGAGGTGGGAAGG + Intergenic
1107074148 13:36302890-36302912 GATGGTTACCAGAGGCTGGGAGG - Exonic
1107853411 13:44591975-44591997 GAGGGGAAGCTGAGGGTGGCTGG + Intergenic
1108468657 13:50745385-50745407 GATGGTTATCAGGGGCTGGGAGG + Intronic
1108771951 13:53713622-53713644 GAGGCTTATAAGACAGTGGCAGG - Intergenic
1108813046 13:54253578-54253600 GAGGCCCATCAGAGGGTGGAAGG + Intergenic
1111032383 13:82620399-82620421 GATGGTTATCAGAGGCTGAGAGG - Intergenic
1111629579 13:90832783-90832805 GGGGGTGATCACAGGGTGGAAGG + Intergenic
1113098381 13:106690548-106690570 GGGGTTTATCAGAGGGTGGTGGG + Intergenic
1113395612 13:109944809-109944831 GAGGGCTATTGGAGGGTGGAGGG + Intergenic
1113419540 13:110159930-110159952 GGGGGTCACCAGAGGCTGGCAGG + Intronic
1113900819 13:113796990-113797012 GAGCTTTCTCAGCGGGTGGCTGG + Intronic
1114056418 14:18971558-18971580 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1114106132 14:19430169-19430191 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1114586635 14:23820563-23820585 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1114941810 14:27622526-27622548 GATGCTTATAAGAGGGAGGCAGG - Intergenic
1115708550 14:36024732-36024754 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1115885236 14:37964048-37964070 GGGGCTTATCAGAAGGTGGATGG - Intronic
1116297099 14:43126089-43126111 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1116506497 14:45688714-45688736 GGGGCTTATCAGAGGGTGGAAGG + Intergenic
1116930095 14:50682194-50682216 GATGGTTACCAGAGGCTGGGAGG - Intergenic
1117165646 14:53029937-53029959 GAGGCCTAGCAGAGGGTGGAGGG - Intergenic
1117534608 14:56691806-56691828 GAGGCTTATAAGAAGGTGGTAGG - Intronic
1118685056 14:68282876-68282898 GAGGTTTCTCAGAGGCTGGGGGG + Intronic
1118758184 14:68860727-68860749 CAGGGTTGTCAGAGGGTCCCAGG - Intergenic
1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG + Intergenic
1120085398 14:80266759-80266781 GAGCCATATCAGAGTGTGGCTGG + Intronic
1120117594 14:80637944-80637966 TAGGGTTTTCAGAGGGAGTCAGG + Intronic
1120138864 14:80904316-80904338 AATGGTTACCAGAGGGTGGCGGG + Intronic
1120277946 14:82401168-82401190 GAGGTCTATCGGAGGGTGGAGGG + Intergenic
1120527000 14:85588777-85588799 GATGGTTACCAGAGGCTGGAAGG - Intronic
1121911947 14:97799740-97799762 GATGGTTACCAGAGGCTGGAGGG + Intergenic
1122189290 14:100027412-100027434 GATGGTTATCAGAGGTGGGAAGG - Intronic
1123498994 15:20862684-20862706 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1123556230 15:21436303-21436325 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1123592468 15:21873649-21873671 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1123800872 15:23819165-23819187 GATGGTTACCAGAGGCTGGGAGG - Intergenic
1123829680 15:24121720-24121742 GAGGCCTATCAGATGGTGGAGGG - Intergenic
1124006154 15:25797131-25797153 GGGGGTTACCAGAGGTTGGAAGG - Intronic
1124850639 15:33335517-33335539 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1125602999 15:40925814-40925836 GACGGGTTTCAGAGGGGGGCCGG - Intergenic
1125697409 15:41651033-41651055 GAGGGTCATCATATGGTGGAAGG + Intronic
1125742655 15:41977452-41977474 GGTGGTTATCAGGGGCTGGCGGG + Intergenic
1126503587 15:49377038-49377060 GATGGTTACCAGAGGCTGGAAGG - Intronic
1126564900 15:50084839-50084861 GATCCTTATCAGAGGGAGGCAGG - Intronic
1126945499 15:53814575-53814597 GAAGGGTACCAGAGGCTGGCGGG - Intergenic
1126951122 15:53882884-53882906 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1126990895 15:54374392-54374414 GAGGGGCATGAGAGGGAGGCCGG - Intronic
1127843378 15:62848871-62848893 GAGAGTTACCAGGAGGTGGCAGG - Intergenic
1127903018 15:63354982-63355004 GAGGTTTATTACAGGGAGGCGGG + Intronic
1128414438 15:67431473-67431495 GAGGCCTATCAAAGGGTGGAGGG + Intronic
1129026540 15:72580100-72580122 GACGGTTACCAGAGGCTTGCGGG - Intronic
1129707507 15:77803080-77803102 GAGGCTTCTTAGAGGGTGGTGGG - Intronic
1129871516 15:78944698-78944720 GGGGGTTCTCGGAGGGTGGGCGG - Intronic
1130754714 15:86750792-86750814 GGGGCCTATCAGAGGGTGGAAGG - Intronic
1131067033 15:89441260-89441282 GAGGGGAGTGAGAGGGTGGCAGG + Intergenic
1202964569 15_KI270727v1_random:163506-163528 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1132535075 16:474843-474865 GAGGTTTATTAGAGCGTGTCTGG + Intronic
1133339900 16:5029335-5029357 GAGGGGGATGAGAGGGTGGCCGG + Intronic
1133591412 16:7247877-7247899 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1133665158 16:7960012-7960034 GGTGGTTATCAGAGGCTGGGTGG + Intergenic
1134753332 16:16644514-16644536 TATGGTTACCAGAGGGTGGGGGG - Intergenic
1134992725 16:18714569-18714591 TATGGTTACCAGAGGGTGGGGGG + Intergenic
1136513175 16:30751615-30751637 GAGGCTTCTCAGATGGTGGCAGG - Intronic
1136581200 16:31152022-31152044 GGGGGTGATCAGAGGATGGGAGG - Intergenic
1138755168 16:59475696-59475718 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1141051923 16:80774375-80774397 GGGGGTTATCAGAGAATGGGTGG + Intronic
1142048737 16:87943892-87943914 GAGGGTTCTCAGAGAATGGTGGG - Intergenic
1143568078 17:7737284-7737306 GAGGGGTTTATGAGGGTGGCCGG + Intronic
1144395205 17:14836617-14836639 GAGCCTTATAAGAGGGAGGCAGG + Intergenic
1145193717 17:20868916-20868938 GAGGGGGAAAAGAGGGTGGCAGG + Intronic
1145351943 17:22091140-22091162 GAGGGGGAAAAGAGGGTGGCAGG + Intergenic
1146396058 17:32467955-32467977 AAGGCCTATCAGAGGGTGGGAGG - Intronic
1146403420 17:32518114-32518136 GAGGGTGATGACAGAGTGGCAGG - Intronic
1146433413 17:32821030-32821052 GAGGCCTATCAGCGGGTGGAAGG - Intronic
1148398607 17:47332579-47332601 GATGGTTATCAGAGGCTGGGGGG - Intronic
1150126343 17:62637721-62637743 GAGGGTAATCAGAAGGTCACAGG - Intronic
1150542578 17:66118542-66118564 GATGGTTACCAGAGGCTGGGAGG + Intronic
1150921704 17:69490871-69490893 GGGGCCTATCAGAGGGTGGAAGG - Intronic
1152055943 17:78026871-78026893 GAGGGATATTTGAGGGTGGAGGG + Intronic
1153098533 18:1437392-1437414 GAGGGAAATCTGAGGGTGGTTGG - Intergenic
1154457037 18:14539430-14539452 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1155157746 18:23171677-23171699 GAGGGTTATCAGAGGGTGGCAGG - Intronic
1155350309 18:24899760-24899782 GAGGCCTGTCAGAGGGTGGGGGG + Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157268303 18:46248367-46248389 GAGGGTGAGCAGTGGGTGGCTGG + Intronic
1158031854 18:52975513-52975535 GGGGCCTATCAGAGGGTGGAAGG - Intronic
1158678747 18:59547254-59547276 GAGGGTTATCTGAGGGGAGCAGG + Intronic
1159951376 18:74486674-74486696 GCCGGTCATCAGAGGGGGGCTGG + Intergenic
1161711721 19:5852410-5852432 GAGAGTTAGCAAAGGGTGGTGGG - Intergenic
1161712566 19:5857534-5857556 GAGAGTTAGCAAAGGGTGGTGGG - Intergenic
1164398417 19:27886361-27886383 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1165291602 19:34890328-34890350 AAGGGTTTTCAGGGGCTGGCAGG - Intergenic
1165810611 19:38609656-38609678 GAGGGATAGCAGGGGGTAGCTGG + Exonic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
926437299 2:12851193-12851215 GATGGTTACCAGAGGCTGGGGGG + Intergenic
926477738 2:13348492-13348514 GGGGCTTATCAGAGGGTGGAGGG - Intergenic
927008478 2:18877431-18877453 GGGGTCTATCAGAGGGTGGAGGG - Intergenic
927594562 2:24385306-24385328 GATGGTTACCAGAGGCTGGAGGG - Intergenic
931380795 2:61751432-61751454 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
931933381 2:67166885-67166907 GAGGCTTATCAGAGGGTGGAGGG + Intergenic
932223429 2:70019740-70019762 GGTGGTTACCAGAGGGTGGCGGG + Intergenic
932891905 2:75604835-75604857 CAGAGTTGTCAGAGGATGGCAGG - Intergenic
932920880 2:75914224-75914246 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
932984481 2:76708786-76708808 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
933477381 2:82808326-82808348 GGGGCTTATCGGAGGGTGGAGGG + Intergenic
933862988 2:86488607-86488629 GGGCGTTTTCAGAGGCTGGCAGG + Intronic
935501716 2:103849116-103849138 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
936003001 2:108852739-108852761 GGGGCCTATCAGAGGGTGGGAGG + Intronic
936260928 2:110959165-110959187 GAGGGTTAATTGAGGATGGCAGG + Intronic
936549071 2:113419342-113419364 GATGGTTACCAGAGGCTGGAAGG + Intergenic
936580371 2:113695108-113695130 GATGGTTACCAGAGGCTGGAGGG + Intergenic
937587123 2:123566432-123566454 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
938336527 2:130505069-130505091 GGGGCCTATCAGAGGGTGGAGGG - Intronic
938353292 2:130615593-130615615 GGGGCCTATCAGAGGGTGGAGGG + Intronic
938474538 2:131595583-131595605 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
938503188 2:131846409-131846431 GGAGCTTATCAGAGGGTGGAGGG - Intergenic
938565717 2:132516601-132516623 GAAGGTTATCAGAGTGTGGCCGG - Intronic
938892573 2:135720402-135720424 GAGGGTTATCAGTAGGTGCTAGG - Intronic
938932895 2:136102278-136102300 GAGGTTTATGAGAGGGTATCGGG - Intergenic
939025911 2:137013745-137013767 GAGGGTTCTCAGAGCCAGGCTGG + Intronic
939421034 2:141969425-141969447 AATGGTTACAAGAGGGTGGCGGG - Intronic
939855486 2:147353886-147353908 GAGGCTTATCAGCGGGTGGAGGG + Intergenic
940406838 2:153313534-153313556 GGGGCCTATCAGAGGGTGGCGGG + Intergenic
940503205 2:154520561-154520583 AATGGTTATCAGAGGCTGGGAGG - Intergenic
940615683 2:156046362-156046384 GAGGGTTACGTGAGGGTGGAGGG + Intergenic
941035635 2:160566016-160566038 GATGGTTATCAGAGGCTAGGGGG + Intergenic
941503226 2:166307951-166307973 TAGGGTTATCAGTGGGTTTCTGG + Intronic
942769633 2:179501562-179501584 GATGGTTACCAGAGGCTGGAAGG + Intronic
942889943 2:180977716-180977738 CAGGGTTGTGAGAGGCTGGCAGG + Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943012917 2:182473643-182473665 GGGGCCTATCAGAGGGTGGAAGG - Intronic
943661396 2:190563198-190563220 GTGGGTGATGAGTGGGTGGCAGG - Intergenic
945809161 2:214527234-214527256 GGGGATTATTAGAGGGTGGAGGG + Intronic
946148165 2:217746520-217746542 GAGACTTATCAGGAGGTGGCTGG - Intronic
946197607 2:218044594-218044616 GGGGTTTATCAGAGGATGGAGGG - Intronic
947297716 2:228651096-228651118 GAGACCTATCAAAGGGTGGCAGG + Intergenic
947776452 2:232714938-232714960 GAGGCCTCTCAGAGGGTGGAGGG - Intronic
947834033 2:233162713-233162735 GAGGGTGAGCAGTGGCTGGCAGG + Intronic
949067250 2:241999541-241999563 GTGTGCTACCAGAGGGTGGCAGG + Intergenic
1169180322 20:3560159-3560181 GGTGGTTACCAGAGGCTGGCAGG - Intronic
1170035071 20:11981462-11981484 GAGGGTTAGTTGAGGATGGCTGG - Intergenic
1171511266 20:25686476-25686498 GAGAGAAGTCAGAGGGTGGCTGG + Exonic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1174336828 20:49868381-49868403 CAGGGTTTTCAGAGAGGGGCAGG + Intronic
1174529324 20:51198595-51198617 GAGGGTTATCAGACTGTGTCTGG + Intergenic
1175701759 20:61143360-61143382 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1175977929 20:62722434-62722456 AAGGCTTATCAGAGGGTGGCTGG - Intronic
1176660573 21:9631339-9631361 GATGGTTACCAGAGGCTGACAGG - Intergenic
1176817121 21:13613907-13613929 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1177090684 21:16763749-16763771 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1177358541 21:20039340-20039362 GGGGCCTATCAGAGGGTGGATGG - Intergenic
1177873888 21:26607785-26607807 GAGGGTTATCACAGGGAGGGAGG + Intergenic
1180474904 22:15694169-15694191 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1180993881 22:19954925-19954947 GGGGGTTATGAGACAGTGGCAGG + Intronic
1181522721 22:23458777-23458799 GAGGGTTCCCAGAGGGCTGCCGG + Intergenic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1182992226 22:34778921-34778943 GGGGCTTATCAGAGGATGGAGGG + Intergenic
1185313192 22:50167964-50167986 GATGGTTATCTGGGGGTGACTGG + Intergenic
949129761 3:485875-485897 GAGGCCTATCAGAGGCTGGAAGG - Intergenic
949200126 3:1367315-1367337 GGTGGTTATCAGAGGCTGGTGGG - Intronic
949962206 3:9321803-9321825 GGGGCCTATCAGAGGGTGGAGGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950852361 3:16074661-16074683 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
951973748 3:28479677-28479699 GGGGTTTATCAGAGGGTGGAAGG - Intronic
953513142 3:43563827-43563849 GACGGTTACCAGAGGCTGGGTGG + Intronic
953731767 3:45455974-45455996 GATGGTTACCAGAGGCTGGAGGG + Intronic
955207282 3:56907855-56907877 GGGGCCTATCAGAGGGTGGAGGG + Intronic
955512343 3:59694083-59694105 GGTGTGTATCAGAGGGTGGCGGG + Intergenic
955546080 3:60031768-60031790 GAGGCTTAGCAGAGGGTGCATGG + Intronic
955841215 3:63114980-63115002 CAGGGTTATCAGCTGGTGACTGG - Intergenic
956995680 3:74824451-74824473 AAGGATTATCAGCGGGGGGCAGG + Intergenic
957681374 3:83440111-83440133 CAGGGCTATCAGATGGTAGCAGG - Intergenic
957771862 3:84704432-84704454 GGGGCTTATCAGAGGGCGGAGGG + Intergenic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
958497753 3:94866034-94866056 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
959096053 3:101957276-101957298 GGTGGTTACCAGAGAGTGGCTGG - Intergenic
959546888 3:107606930-107606952 GATGGTTACCAGAGAGTGGGGGG - Intronic
960006256 3:112784119-112784141 GAGAGTTAGCAAAGGGTGGTGGG + Intronic
960405831 3:117258274-117258296 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
960668770 3:120136594-120136616 GATGGTTACCAGAGGCTGGGGGG + Intergenic
962401260 3:135060952-135060974 GATGGTTACCAGAGGCTGGGAGG - Intronic
962857637 3:139363276-139363298 GAGGGTGAGCAGTGGGTGGGTGG + Intronic
963276073 3:143331241-143331263 GAGGGTTATGAGGGGCTGGTGGG + Intronic
963587102 3:147205824-147205846 GAGGCCTATCAGGGGGTGTCGGG - Intergenic
963592133 3:147273932-147273954 GATGGTTACCAGAGGCTGGGAGG + Intergenic
964287450 3:155134292-155134314 GAGGATTAATAGAGGGTGGAGGG - Intronic
964678345 3:159309003-159309025 GTGGACTATGAGAGGGTGGCAGG + Intronic
964936143 3:162090379-162090401 GATGGTTACCAGAGGCTGGGAGG - Intergenic
965312355 3:167145832-167145854 GAGGCCTATCAGAGGTTGGAGGG - Intergenic
965747262 3:171938450-171938472 GAGACATATCAGAAGGTGGCAGG + Intronic
965808417 3:172566787-172566809 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
966145702 3:176809291-176809313 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
966833200 3:184028863-184028885 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
967037927 3:185662010-185662032 GAGGGTTAGCAGGATGTGGCGGG + Intronic
967039930 3:185682397-185682419 GAGGGTTATCCTATGGTGGAAGG - Intronic
967548225 3:190758133-190758155 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
972043377 4:34632842-34632864 GATGGTTATCAGAGGCTGAGAGG + Intergenic
972147460 4:36045517-36045539 GGTGGTTATCAGAGGCTGGGGGG + Intronic
972470916 4:39403696-39403718 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
972883441 4:43454956-43454978 GATGGTTTCCAGAGGCTGGCAGG - Intergenic
973160683 4:47012350-47012372 GTGGCCTATCAGAGGGTGGAGGG - Intronic
973167416 4:47094597-47094619 GGGGCCTATCAGAGGGTGGAGGG + Intronic
973224839 4:47771595-47771617 GGGGTCTATCAGAGGGTGGAGGG - Intronic
974523955 4:63023831-63023853 GGGGCCTATCAGAGGGTGGATGG + Intergenic
974749723 4:66121729-66121751 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
974797383 4:66770364-66770386 GGGGGCTATCAGAGGGTAGAGGG - Intergenic
974806872 4:66891953-66891975 GAGGCCTTTCAGAGGGTGGGAGG + Intergenic
974989413 4:69066309-69066331 GAGGCTTTTTAGAGGGTGGAGGG - Intronic
975231013 4:71933016-71933038 GGGACTTATCAGAGGGTGGAGGG + Intergenic
976360752 4:84175317-84175339 GGTGGTTACCAGAGGCTGGCGGG + Intergenic
976547925 4:86359403-86359425 GAGGGGTAGCAGAGGGAGGGAGG - Intronic
977220183 4:94328839-94328861 GAGGGTCATCAGAGTGTGACTGG - Intronic
977342019 4:95771213-95771235 GATGGTTACCAGAGGCTGGGAGG + Intergenic
977517314 4:98036643-98036665 GAGGTCTTTCAGAGGGTGGAGGG + Intronic
977595289 4:98872870-98872892 GGGGCCTATCAGAGGGTGGAGGG + Intronic
978052023 4:104212821-104212843 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
978131174 4:105199695-105199717 GGGGCCTATCAGAGGGTGGAGGG - Intronic
978519522 4:109601402-109601424 GATGGTTACCAGAGGCTGGGAGG - Intronic
978590455 4:110318748-110318770 GATGGTTATCAGGGGTTGGGGGG - Intergenic
978716171 4:111845845-111845867 GGGGTCTATCAGAGGGTGGAGGG + Intergenic
981012121 4:139936044-139936066 GATGGTTATCTGAGGCTGGGAGG - Intronic
981054672 4:140348317-140348339 GATGATTATCAGAGGTTGGAGGG - Intronic
981944801 4:150328733-150328755 GAGGGCAGTCAGAGGGTGGGTGG + Intronic
983283327 4:165708521-165708543 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
985370233 4:189278987-189279009 GGGAGTCATCAGAGGGTGGGTGG + Intergenic
985414788 4:189725075-189725097 GATGGTTACCAGAGGCTGACAGG + Intergenic
986054323 5:4120881-4120903 GAGGTCTACCAGAGGGTGGATGG + Intergenic
986272117 5:6242467-6242489 GAGGCATATCAGAGGGTGGAGGG + Intergenic
987227332 5:15856386-15856408 GGGGCCTATCAGAGGGTGGAAGG + Intronic
988081870 5:26425622-26425644 GAGGATTAAGAGAGAGTGGCCGG - Intergenic
989070310 5:37503421-37503443 GGGGCCTATCAGAGGGTGGAGGG - Intronic
989558857 5:42828229-42828251 GAGGCTTATTGGAGGGTGGAGGG - Intronic
989992412 5:50782873-50782895 GAGGCTCATCAGAGAGTGGTAGG + Intronic
990330169 5:54718014-54718036 GACGGTTACCAGGGGCTGGCGGG + Intergenic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
993023171 5:82616373-82616395 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
993283395 5:85958129-85958151 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
994227379 5:97268526-97268548 GAGGCCTATCAGAGGATGGAGGG - Intergenic
994345224 5:98677303-98677325 GATGGTTACCAAAGGCTGGCAGG + Intergenic
994824361 5:104694716-104694738 GAGGGTTGTCAGGGGGTGATAGG - Intergenic
995692086 5:114838651-114838673 GATGGTTACCAGAGGCTGGGAGG + Intergenic
996345512 5:122484267-122484289 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
996541384 5:124632918-124632940 GATCATTATAAGAGGGTGGCAGG + Intergenic
998655252 5:144171287-144171309 GAGGGTTATCAAAGGGTGAGTGG + Intronic
998877676 5:146617206-146617228 GATGGTTACCAGAGGTTGGGGGG + Intronic
999029154 5:148270785-148270807 GATTCTTATCAGAGGGAGGCAGG + Intronic
999612025 5:153380267-153380289 GAGGCTTATGAGAGTGTGGGAGG + Intergenic
999943547 5:156570801-156570823 GGGGCCTATCAGAGGGTGGAGGG - Intronic
999983724 5:156983147-156983169 GGGGCTTATCAGAGGGTGGAGGG + Intergenic
1000448325 5:161352532-161352554 GACGGTTACCACAGGCTGGCAGG + Intronic
1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG + Intronic
1001660396 5:173387299-173387321 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1002428398 5:179188979-179189001 GGGGGTTAGCAGAGTGTGGGGGG + Intronic
1002579141 5:180197094-180197116 GAGGCTCATCAGAGGCAGGCTGG - Intronic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1006004979 6:30994432-30994454 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1006074487 6:31522388-31522410 GGTGGTTATCAGAGGCTGGGAGG + Intergenic
1006430613 6:33993435-33993457 GAGGGGTGTCAGAGTGAGGCTGG + Intergenic
1006805134 6:36783209-36783231 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1006992504 6:38227531-38227553 GAAGGTGATCAGAAAGTGGCTGG + Intronic
1007688130 6:43679623-43679645 GTGGGTTATGAGAGTGAGGCTGG + Intronic
1007703286 6:43776612-43776634 CGGGGTTATCAGTGGCTGGCAGG + Intronic
1009455813 6:63854442-63854464 GAGGCCTATCAGGGGGTGGGTGG + Intronic
1009533536 6:64851785-64851807 GTGGCTTTTCAGAGGGTGGAGGG + Intronic
1009628166 6:66163151-66163173 GATGGCTATCAGGGGCTGGCCGG + Intergenic
1009730955 6:67605842-67605864 GGGGCATATCAGAGGGTGGAGGG + Intergenic
1009747797 6:67841512-67841534 GAGCCTTTTCAGAGGGTGGAGGG - Intergenic
1010371360 6:75112201-75112223 GCGGCCTATCAGAGGGTGTCAGG + Intronic
1010476229 6:76291671-76291693 GGTGGTTATCAGAGGTTGGGTGG + Intergenic
1011263859 6:85495899-85495921 GAGGGTTATCAGATGGTAAGTGG - Intergenic
1011967234 6:93174165-93174187 AAGGGATCTCAGAGGCTGGCGGG + Intergenic
1012008153 6:93743104-93743126 GAGGCCTATTAGAGGGTGGAGGG + Intergenic
1012299926 6:97573628-97573650 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1012823533 6:104120212-104120234 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1013059899 6:106623374-106623396 GGGGTTTTTCAGAGGGTGGAGGG + Intronic
1013452019 6:110291696-110291718 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1014315193 6:119855786-119855808 GGGGCTTTTCAGAGGGTGGAGGG + Intergenic
1014495248 6:122113661-122113683 GGTGGTTATCAGAGGCTGCCTGG - Intergenic
1014510857 6:122320408-122320430 GGGGTGTATCAGAGGGTGGAGGG - Intergenic
1015419918 6:132995647-132995669 CAGGGTTACCAGAGTGGGGCTGG - Intergenic
1015592766 6:134838388-134838410 GGGACTTATCAGAGGGTGGAGGG - Intergenic
1017204326 6:151788941-151788963 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1017679251 6:156846857-156846879 GACAGGAATCAGAGGGTGGCGGG - Intronic
1017921931 6:158880475-158880497 GAGAGTTAGCAAAGGGTGGTGGG + Intronic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019504846 7:1385654-1385676 GGGGGTTCTGAGAGGCTGGCAGG - Intergenic
1019588604 7:1817760-1817782 GAGGGTTCCCAGAGGGCTGCCGG - Intronic
1020404640 7:7818142-7818164 GGGTCTTATCAGAGGGTGGAAGG - Intronic
1020478723 7:8630928-8630950 GAGGCCTTTCAGAGGGTGGAGGG - Intronic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022875759 7:34527648-34527670 GGGGATTATAAGAGGGTGTCAGG - Intergenic
1023421535 7:39985127-39985149 GACGGTTACCAGAGGCTGGAGGG - Intronic
1023528548 7:41130185-41130207 GAGGGTGGGCAGTGGGTGGCAGG - Intergenic
1024528084 7:50366096-50366118 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1025489125 7:61089945-61089967 GATGGTTGTCAGAAGGTGGGGGG - Intergenic
1026068476 7:67096735-67096757 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1026668261 7:72363177-72363199 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1026708437 7:72715577-72715599 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1027571037 7:79867394-79867416 GAGGCCTGTCAGAGGGTGGAGGG + Intergenic
1028001676 7:85505794-85505816 GATGGTTATCAGAGTTTGGGAGG + Intergenic
1028026266 7:85844348-85844370 GATGTTTATCAGAGGCTGGAGGG + Intergenic
1028365700 7:90028266-90028288 GATGGTTACCAGAGGTTGGGAGG + Intergenic
1028382809 7:90217423-90217445 GAGAGATATCAGAGGCTGGAAGG - Intronic
1028473608 7:91230764-91230786 GAGGGTGATGAGTGAGTGGCAGG - Intergenic
1028858435 7:95618824-95618846 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1029673983 7:102053595-102053617 GATGGTTACCAGAGGCTGGGAGG - Intronic
1029878665 7:103781672-103781694 GGGGGTTATCAGGGGCTGGGTGG - Intronic
1029907634 7:104107538-104107560 GGGGCCTATCAGAGGGTGGGGGG - Intergenic
1030333290 7:108296011-108296033 GAGAGTTCCCAGAGGGTGTCTGG + Intronic
1030969134 7:116032670-116032692 GGGGCCTATCAGAGGGTGGAAGG + Intronic
1031894428 7:127332069-127332091 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1032195552 7:129786344-129786366 GAGGGTTATCATGGGGTCCCTGG + Intergenic
1032301604 7:130692407-130692429 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1032322468 7:130897627-130897649 GCGGGTCATCTGAGGGAGGCTGG + Intergenic
1032522306 7:132554645-132554667 GAGGGTTCTCACTGGCTGGCTGG + Intronic
1033084450 7:138329568-138329590 GAGAGTCAGCAAAGGGTGGCGGG - Intergenic
1033717172 7:144014519-144014541 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1033877054 7:145834437-145834459 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1034693517 7:153033531-153033553 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1035683844 8:1508442-1508464 GGGGGTTTGCAGAGGGTGGCGGG - Intronic
1036779652 8:11637003-11637025 GAGAGTTATCTGAGGGGGGAGGG + Intergenic
1037255922 8:16953525-16953547 GATGGTTATCAGAGGCTGGCTGG + Intergenic
1040539555 8:48340051-48340073 GGGGCTTTTCAGAGGGTGACAGG - Intergenic
1041063320 8:54057644-54057666 TATGGTTATCAGAGGCTGGAAGG + Intronic
1041116808 8:54547949-54547971 GTGGCCTATCAGAGGGTGGAGGG + Intergenic
1041976696 8:63807278-63807300 GATGGTTAGCAGAGGCTGGGGGG + Intergenic
1042955016 8:74240416-74240438 GATGGTTACCAGAGGCTGGATGG - Intronic
1042986682 8:74592116-74592138 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1043258906 8:78172776-78172798 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
1043397115 8:79849212-79849234 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1044128396 8:88488044-88488066 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044602820 8:94022774-94022796 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1044804512 8:95991477-95991499 GAGGCCTTTCAGAGGGTGGAGGG + Intergenic
1045148940 8:99381057-99381079 GGGGCCTATCAGAGGGTGGAGGG - Intronic
1045811042 8:106220416-106220438 GGGGCATATCAGAGGGTGGAGGG + Intergenic
1046433764 8:114161709-114161731 GAAGGTTACCAGAGGCTGGTTGG - Intergenic
1046794271 8:118353842-118353864 GAGTGGTATCAGTGGGAGGCAGG + Intronic
1048545455 8:135382473-135382495 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1049903871 9:197508-197530 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1050196801 9:3093387-3093409 GGGGCCTATCAGAGGGTGGACGG - Intergenic
1050323093 9:4473629-4473651 GGGGCTTATCAGAGAGTGGAGGG + Intergenic
1052180753 9:25524511-25524533 GGGGCATATCAGAGGGTGGAGGG - Intergenic
1052733968 9:32321246-32321268 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1053139436 9:35673621-35673643 CAGGGTTAGCTGAGGCTGGCTGG + Intronic
1053193731 9:36098003-36098025 AGTGGTTACCAGAGGGTGGCTGG + Intronic
1053746877 9:41207807-41207829 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1054480407 9:65657552-65657574 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1054681467 9:68223474-68223496 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1054888896 9:70230668-70230690 GAGGGGTTGCAGAGGGTGTCTGG - Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055539001 9:77281109-77281131 GATGGTTACCAGAGGGTAGCAGG + Intronic
1055683769 9:78747033-78747055 GGAGGTTATCAGAGGCTGGAGGG - Intergenic
1056108972 9:83375706-83375728 GGGGCCTATCAGAGGGTGGAGGG + Intronic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1058264402 9:102880066-102880088 GGGGGTTACCAGAGGTTGGTAGG + Intergenic
1058567554 9:106302682-106302704 GGGGCTTAGCAGAGGGTGTCTGG + Intergenic
1059915930 9:119100160-119100182 GGGGCCTATCAGAGGGTGGAAGG - Intergenic
1059972512 9:119682178-119682200 GAGGCCTTTCAGAGGGTGGAGGG - Intergenic
1060342647 9:122790504-122790526 GGGGCTTATCGGAGGGTGGAGGG + Intergenic
1061018999 9:128001849-128001871 GATGCTAATCAGAGGCTGGCTGG - Intergenic
1061749522 9:132767933-132767955 GATGGTTACCAGAGGCTGGGAGG + Intronic
1202783008 9_KI270718v1_random:18587-18609 GATGGTTACCAGAGGCTGGAAGG - Intergenic
1203530240 Un_GL000213v1:135584-135606 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1203638142 Un_KI270750v1:133183-133205 GATGGTTACCAGAGGCTGACAGG - Intergenic
1185718132 X:2359913-2359935 GAGGCCTATCAGAAGGTGGGAGG + Intronic
1186122263 X:6375936-6375958 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1186782323 X:12925435-12925457 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1187563246 X:20422424-20422446 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1187845407 X:23531405-23531427 GATGGTTAACAGAGGCTGGGAGG + Intergenic
1188012167 X:25068792-25068814 AAGGGTTCTTAGAGGGAGGCAGG - Intergenic
1188337732 X:28958276-28958298 GGTGGTTACCAGAGGGTGACTGG - Intronic
1188534962 X:31186489-31186511 GTGGCTTATCAGAGGATGGAGGG + Intronic
1188550992 X:31364398-31364420 GAGGGTGTTAAGAGGATGGCAGG + Intronic
1189536280 X:41938599-41938621 GAGGTTTATAAGGGGGAGGCAGG - Intergenic
1189722339 X:43933174-43933196 GAGAGGATTCAGAGGGTGGCTGG - Intergenic
1189964399 X:46357026-46357048 GATGGTTACCAGAGGCTGGGAGG - Intergenic
1190715219 X:53097222-53097244 GAGGGGTATGAGAGGGCTGCCGG - Intergenic
1191227455 X:58059037-58059059 GACGTTTATCAGAGGGCGGAGGG - Intergenic
1191700419 X:64036099-64036121 GAGGCCTATCAGAGGCTGGACGG + Intergenic
1191777525 X:64832414-64832436 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1191994255 X:67073930-67073952 CAGGCTTTTCAGAGGGTGGAGGG + Intergenic
1192022768 X:67411727-67411749 GAGGCCTTTCAGAGGGTGGAAGG - Intergenic
1192595626 X:72405132-72405154 GGGGCTTATCAGAGGATGGAGGG - Intronic
1192717085 X:73655059-73655081 GGGGCTTGTCAGAGGGTGGGAGG - Intronic
1192867226 X:75147658-75147680 GGGGCCTATCAGAGGGTGGAAGG + Intronic
1193397197 X:80999636-80999658 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1193593208 X:83415216-83415238 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1193615435 X:83682704-83682726 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1193629768 X:83869369-83869391 GGGGTCTATCAGAGGGTGGAGGG - Intronic
1193634529 X:83931985-83932007 GGGGCCTATCAGAGGGTGGAGGG - Intergenic
1193754450 X:85390134-85390156 GGGGTCTATCAGAGGGTGGAGGG + Intergenic
1194101556 X:89711700-89711722 GGGGTCTATCAGAGGGTGGAGGG - Intergenic
1194523877 X:94951960-94951982 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1195567299 X:106357434-106357456 GAAGCCTATCAGAGGGTGGAGGG - Intergenic
1195695334 X:107662945-107662967 GGGGGTTAAGAGAGGGTGGGTGG - Intergenic
1196239234 X:113321659-113321681 GGGGCCTATCAGAGGGTGGAAGG + Intergenic
1196289611 X:113923663-113923685 GATGGTTACCAGAGGCTGGGAGG - Intergenic
1196672649 X:118385492-118385514 GAGGCCTATCAGAGGGTGAAGGG + Intronic
1196994553 X:121367399-121367421 GGGGCCTATCAGAGGGTGGAGGG + Intergenic
1197359917 X:125488515-125488537 GGGGCTTATCAGAGGGTGGAGGG - Intergenic
1197360633 X:125498470-125498492 GAGAGTAGTCAGCGGGTGGCAGG - Intergenic
1197683911 X:129417656-129417678 GGTGGTTATCAGAGCGTGGAGGG + Intergenic
1198268104 X:135029836-135029858 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1198501187 X:137248815-137248837 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
1198614994 X:138447314-138447336 CATGGTTATCAGAGGCTGGTGGG - Intergenic
1199048783 X:143210440-143210462 GATGGTTACCAGAGGCTGGAAGG + Intergenic
1199218699 X:145291656-145291678 GGGGCTTATCAGAGGGTGGAAGG + Intergenic
1200120307 X:153787084-153787106 GAAGGTGATCTGAGGGTAGCGGG + Exonic
1200427626 Y:3039040-3039062 GATGGTTACCAGAGGCTGGGAGG + Intergenic
1200454504 Y:3372786-3372808 GGGGTCTATCAGAGGGTGGAGGG - Intergenic