ID: 1155159396

View in Genome Browser
Species Human (GRCh38)
Location 18:23183365-23183387
Sequence AGGGAAAACGGTTCCTCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155159396_1155159402 0 Left 1155159396 18:23183365-23183387 CCCACGGAGGAACCGTTTTCCCT 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1155159402 18:23183388-23183410 TCATGATGAGTGGATTAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 141
1155159396_1155159403 10 Left 1155159396 18:23183365-23183387 CCCACGGAGGAACCGTTTTCCCT 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1155159403 18:23183398-23183420 TGGATTAATTTGGTCCACGTAGG 0: 1
1: 0
2: 0
3: 4
4: 49
1155159396_1155159399 -10 Left 1155159396 18:23183365-23183387 CCCACGGAGGAACCGTTTTCCCT 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1155159399 18:23183378-23183400 CGTTTTCCCTTCATGATGAGTGG 0: 1
1: 0
2: 1
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155159396 Original CRISPR AGGGAAAACGGTTCCTCCGT GGG (reversed) Intronic
918211693 1:182357193-182357215 AGGGAAAATGGATACTTCGTAGG - Intergenic
1064324735 10:14339580-14339602 AGGGAAAATAATTCCTCCGCTGG - Intronic
1090763242 11:129855245-129855267 AGGCAAGACGGTACCTCCCTGGG - Intronic
1091020799 11:132097822-132097844 AGGGAAAAGGGTTCCGGCATTGG + Intronic
1106820689 13:33461478-33461500 AGAGATAAGGGTTCCTCAGTGGG + Intergenic
1112505534 13:99972438-99972460 AGGTAAAACGGTTCCTTTGGGGG - Intergenic
1127431849 15:58918281-58918303 AGGGAAAAAAGTTCATTCGTTGG - Intronic
1127568642 15:60218435-60218457 AGGGAAAACGCTGCCTACTTAGG - Intergenic
1146182525 17:30707322-30707344 AGGGAAAAGGGTTCCTGAGTAGG - Intergenic
1149664088 17:58353798-58353820 AGGGAAAAAGGTTCCCAGGTGGG + Exonic
1155159396 18:23183365-23183387 AGGGAAAACGGTTCCTCCGTGGG - Intronic
1162976296 19:14208483-14208505 AGGGAAAAGGGTTCCTGAGTAGG + Intergenic
1165988216 19:39789226-39789248 AGGGAACACGTTTACACCGTTGG + Intergenic
935246726 2:101225228-101225250 AGAGAAAACCTTTCCTCTGTGGG - Intronic
935819876 2:106884245-106884267 AGGGAAAAGGTTTACTCTGTGGG - Intronic
938192867 2:129299514-129299536 AGGGGAAATGCTTCCTCCTTAGG + Intergenic
939764101 2:146224500-146224522 AAGGAAAACAGATACTCCGTTGG - Intergenic
1177646392 21:23904364-23904386 AGGGAAAATGTTTCCACCATTGG + Intergenic
1181499142 22:23305892-23305914 AGGGAAAACTGTTTCCCCCTTGG + Intronic
955239753 3:57168222-57168244 AGAGAAAACTGTTTCTCCCTGGG + Intronic
956046497 3:65201268-65201290 AGAGACAAGGGTTCCTCCTTTGG - Intergenic
956722914 3:72134030-72134052 AGGGCAAACGATTCCTCCTTAGG - Intergenic
970321083 4:14876077-14876099 AGGGAAAAATGTTTCTCTGTAGG - Intergenic
984852355 4:184165095-184165117 AGGTAAAGCGCTTCCTCAGTGGG - Intronic
985629664 5:1008100-1008122 AGGGAAGAAGGTTCCTCTGAAGG + Intergenic
985654426 5:1122532-1122554 TGGGAATGCGGTTCGTCCGTCGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996299154 5:121960835-121960857 AGGAAAAACGTTTCTTCCGGCGG - Intergenic
1001536139 5:172499252-172499274 AGGGAAAATTGTTCCTTCTTCGG - Intergenic
1006913013 6:37576208-37576230 TGGGAAAGCGGCTCCTCAGTGGG - Intergenic
1009501832 6:64423520-64423542 AAGGAAAGCGATTCCTCTGTTGG - Intronic
1057214277 9:93219444-93219466 AGGGAAAGGGCTTCCTCCCTAGG - Intronic
1057644323 9:96858970-96858992 AGTGTAAATGTTTCCTCCGTGGG - Intronic
1057752837 9:97805877-97805899 AGGAAAAACAGTTGCTCCTTTGG + Intergenic
1059742279 9:117163659-117163681 AGGGAGAATGGTTCCTGAGTTGG - Intronic
1185992521 X:4907416-4907438 AGGGAGAAAGGTTACTGCGTTGG - Intergenic
1187053697 X:15719371-15719393 AGAGAAAAAGCTTCCTCAGTTGG - Intronic
1191608415 X:63085880-63085902 AGGGCAAACGGGTGCTCAGTGGG + Intergenic