ID: 1155159885

View in Genome Browser
Species Human (GRCh38)
Location 18:23186822-23186844
Sequence CCACCCTGGATGGGTAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155159878_1155159885 5 Left 1155159878 18:23186794-23186816 CCTAGGCATTCTCCTGTGTAGAA 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1155159885 18:23186822-23186844 CCACCCTGGATGGGTAACATGGG 0: 1
1: 0
2: 0
3: 11
4: 82
1155159877_1155159885 6 Left 1155159877 18:23186793-23186815 CCCTAGGCATTCTCCTGTGTAGA 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1155159885 18:23186822-23186844 CCACCCTGGATGGGTAACATGGG 0: 1
1: 0
2: 0
3: 11
4: 82
1155159879_1155159885 -7 Left 1155159879 18:23186806-23186828 CCTGTGTAGAATTACACCACCCT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1155159885 18:23186822-23186844 CCACCCTGGATGGGTAACATGGG 0: 1
1: 0
2: 0
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155159885 Original CRISPR CCACCCTGGATGGGTAACAT GGG Intronic
900783113 1:4630800-4630822 CCATCCTGGAGGGGTAACCCTGG - Intergenic
901856587 1:12048186-12048208 CCAGCCTGCCTGGGCAACATAGG + Intergenic
902135365 1:14300429-14300451 CCAGCCTGGCTGGGCAACATAGG - Intergenic
912648135 1:111414669-111414691 CACCCCAGGATGGGTAACTTGGG - Exonic
912712610 1:111960645-111960667 TCAGCCTGTATGGTTAACATGGG - Intronic
913200080 1:116488812-116488834 TCACCCTGGCTGGGTGACCTTGG - Intergenic
1064860614 10:19821048-19821070 CCAGCCTGGATGGGCGACAAAGG + Intronic
1067881480 10:50049462-50049484 CCAGCCAGGATGGGAAACAAAGG + Intergenic
1070519916 10:77243758-77243780 CCACTGTGGAAGGGTAACACAGG - Intronic
1070609055 10:77921056-77921078 CCACCCTGCATGGCTAATTTAGG - Intronic
1070686845 10:78491269-78491291 GCACCCTGGCTGGGATACATGGG - Intergenic
1072658553 10:97347769-97347791 CACCCCTGGTTGGGTAACCTTGG + Intergenic
1073812019 10:107162899-107162921 CAACCAAGGATGGGTAAAATGGG - Intronic
1080579787 11:33632789-33632811 CCAGCCTCTATGGGCAACATAGG - Intronic
1083484901 11:62977127-62977149 CCACCCTGCATGTGTTACCTGGG + Exonic
1084908693 11:72369814-72369836 CCTCCCTGGATGGGAAATAAAGG - Intronic
1086428974 11:86716940-86716962 CCAGCATGGGTGGGTAACTTAGG + Intergenic
1091975146 12:4818369-4818391 CCTCCTTTGCTGGGTAACATGGG + Intronic
1094659558 12:32454216-32454238 TCACACTGGATGAGTAATATGGG + Intronic
1100416689 12:94385212-94385234 CCTCCCTGGATGGGAAGCGTAGG + Intronic
1102668122 12:114593682-114593704 CCACCCTGGATGGAGTACAGTGG + Intergenic
1104165490 12:126225289-126225311 TCACTCAGGATGGGTCACATTGG - Intergenic
1104737194 12:131143019-131143041 CCACCCTGGATGGGTGGCACCGG - Intergenic
1112781813 13:102909079-102909101 CCACTCTGGTTGGGAACCATAGG + Intergenic
1118380290 14:65212472-65212494 CCACCCCAGATGGGTGACTTGGG + Intergenic
1122682832 14:103479226-103479248 CCAGCCTGGCTGGGCTACATAGG - Intronic
1125144812 15:36454481-36454503 CCACCATTGATGGGTCACATGGG + Intergenic
1125514493 15:40310164-40310186 CCACCCTGGAGGGGTGAGACTGG - Intergenic
1127393058 15:58522275-58522297 CCTCCCTGGCTGGGTAGCATGGG + Intronic
1132311368 15:100860401-100860423 CCACCATGGATGTGTAGCAGCGG + Intergenic
1135303359 16:21349524-21349546 GCCCCCAGGATGGGGAACATGGG + Intergenic
1142803806 17:2361345-2361367 CCACCCTGAATGGGGAGCTTTGG + Intronic
1143533563 17:7521534-7521556 CCAGCCTGGGTGGGTGACAGAGG + Intergenic
1144708771 17:17386881-17386903 CCACCCTGAATTGGCAAAATTGG + Intergenic
1146594453 17:34156958-34156980 TCCCCCAGGATGGTTAACATGGG - Intronic
1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG + Intronic
1149530561 17:57391625-57391647 CCACCCTGGGTGGGCAACTCGGG + Intronic
1150327823 17:64270934-64270956 CCACCCAGGAGGGAAAACATCGG + Intergenic
1153915549 18:9741479-9741501 CCACCGTGGATGGATCACAAGGG + Intronic
1155159885 18:23186822-23186844 CCACCCTGGATGGGTAACATGGG + Intronic
1159854770 18:73572544-73572566 CCTCACTGTATGGGTATCATAGG + Intergenic
1162462625 19:10822217-10822239 CCAGCCTGGGTGGGTGACAGAGG - Intronic
1162559605 19:11408672-11408694 GCACCCTGGAGGGGAAACTTTGG + Intronic
1165826439 19:38708558-38708580 GGACCCTGCATGGGCAACATGGG - Intronic
1167279424 19:48558253-48558275 ACGCCCTGGATGGGGAACTTGGG + Intronic
1167664991 19:50818653-50818675 CCACCCTGGCTGGGCACCAGGGG - Intergenic
926496015 2:13589601-13589623 CCACCTTGCATGGGTACCTTTGG + Intergenic
927905616 2:26853837-26853859 CCACCCAGCCTGGGAAACATAGG + Intronic
929613871 2:43292889-43292911 CCACCCTTGCTGTGCAACATGGG - Exonic
936718047 2:115213383-115213405 TCACCATGGATGGGTGACATGGG - Intronic
945039357 2:205731112-205731134 CCACCCTGTATGAGAATCATAGG - Intronic
946959768 2:224971498-224971520 CCACACCGGATGGGTGACTTTGG + Intronic
946990846 2:225327980-225328002 CCACCCAGGCTGGGGAGCATAGG + Intergenic
948122222 2:235539565-235539587 CCACCCTAGAGGGGAAATATGGG - Intronic
948202411 2:236138931-236138953 ACTCCCAGGATGGGTACCATTGG + Intergenic
1172982906 20:38958093-38958115 CGACCCTGGATGTGGAACATGGG + Intergenic
1175102278 20:56587969-56587991 ACACCCAGGCTGGGTAACAATGG - Intergenic
1178286292 21:31328118-31328140 CCCCACTGCATGGGTGACATTGG - Intronic
1181993401 22:26855668-26855690 CCACCCTAGATGGGGAAATTAGG - Intergenic
957046436 3:75378610-75378632 CCACCAGAGATGGATAACATGGG + Intergenic
960678457 3:120221691-120221713 CCAGCCTGGGTGGGTGACAGAGG - Intronic
961509111 3:127390456-127390478 CGACCCTGCATGGGTCACAGTGG + Intergenic
966311904 3:178603004-178603026 ACAGCCTGGATGAGTAACGTGGG + Intronic
968789569 4:2650304-2650326 CCACCCTGCGTGGGTGCCATGGG - Intronic
969824619 4:9747620-9747642 CCACCAGAGATGGGCAACATGGG - Intergenic
972555281 4:40175229-40175251 CAAACCTGCCTGGGTAACATGGG - Intergenic
975649115 4:76574293-76574315 TCACCCTGGATAGGTTACAATGG + Intronic
987250386 5:16094994-16095016 CCTCACTGGATGTGTAACCTTGG - Intronic
990190903 5:53259487-53259509 CCTCCTTGGAAGGCTAACATGGG - Intergenic
992584958 5:78229129-78229151 CCAGCCTGGGTAGGCAACATAGG - Intronic
995580197 5:113591250-113591272 CCACCCTGAATCAGTAAAATGGG + Intronic
997188881 5:131911042-131911064 CTACCCTGGAGGGTTAGCATTGG - Intronic
1001325474 5:170720582-170720604 CCACCCTGGAAGGGGAAGAAGGG + Intronic
1002085313 5:176771247-176771269 CCACCCAGCCTGGGTTACATGGG + Intergenic
1002085324 5:176771284-176771306 CCACCCTGCCTGGGTTACATGGG + Intergenic
1002085334 5:176771321-176771343 CCACCCTGCCTGGGTTACATGGG + Intergenic
1003510046 6:6772137-6772159 CCTCCCTGGATGGTTAATATTGG - Intergenic
1015461814 6:133500278-133500300 CCACCATGCATGGGGAACACCGG - Intronic
1022925502 7:35052448-35052470 CCACCATGGCTGGGAACCATTGG + Intergenic
1029823511 7:103167145-103167167 CCACCATGGCTGGGAACCATTGG + Intergenic
1031097230 7:117434831-117434853 CCCTCCTGGATAGATAACATTGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1034148573 7:148894298-148894320 TCACCCTGGATTGGGAACAGTGG - Intergenic
1034863399 7:154619520-154619542 CCTCCCTGGCTGTGTAATATAGG - Intronic
1043591981 8:81843248-81843270 AGACCCTCCATGGGTAACATTGG - Intergenic
1045267298 8:100630586-100630608 TCACCCTGGATGGGTGTCATGGG - Intronic
1051544615 9:18260175-18260197 CCACCATGGATGGTAAAAATGGG + Intergenic
1057623387 9:96655717-96655739 CCAGCCTGGGTAGGTAACAGAGG + Intergenic
1061541633 9:131280578-131280600 CCACCCGGGATGGTGAACACTGG + Intergenic
1189566439 X:42246411-42246433 CCTCCATGGATGAGTGACATGGG - Intergenic
1194317385 X:92396811-92396833 CCAGCCTGGGTGGGTGACAGAGG + Intronic
1200625561 Y:5510118-5510140 CCAGCCTGGGTGGGTGACAGAGG + Intronic
1201510169 Y:14750420-14750442 GCACCCTGGAAGGCTAACATTGG - Intronic
1201719442 Y:17080663-17080685 CCACCCTAGAAGGTTGACATGGG + Intergenic