ID: 1155161647

View in Genome Browser
Species Human (GRCh38)
Location 18:23201041-23201063
Sequence CAGGGAGAGCAGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2186
Summary {0: 1, 1: 2, 2: 39, 3: 372, 4: 1772}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1155161640_1155161647 15 Left 1155161640 18:23201003-23201025 CCAGAAGCCTCGTAGTCAGCCAT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG 0: 1
1: 2
2: 39
3: 372
4: 1772
1155161643_1155161647 -4 Left 1155161643 18:23201022-23201044 CCATGTGGAAAGCTAAAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG 0: 1
1: 2
2: 39
3: 372
4: 1772
1155161642_1155161647 8 Left 1155161642 18:23201010-23201032 CCTCGTAGTCAGCCATGTGGAAA 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG 0: 1
1: 2
2: 39
3: 372
4: 1772
1155161639_1155161647 16 Left 1155161639 18:23201002-23201024 CCCAGAAGCCTCGTAGTCAGCCA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG 0: 1
1: 2
2: 39
3: 372
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1155161647 Original CRISPR CAGGGAGAGCAGAAGCAGGA AGG Intronic
Too many off-targets to display for this crispr